Rroxscaffold_1G00012760

zinc finger CCCH domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000725
Physical Location & Seq
Reverse (-)
15612119 .. 15615840
3722 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00012760.1

Sequence Viewer

Length: 150 bp
ATGGCCTCTAACGAGGATCTAATAATATTTTCGGATATCGTTCTGTGCTGTGGAATAATGGATACTCGTAAACAAGGGAGGAATGAAGCTACTGGCTTTCATGCTAATGGAGGCTTTAAGAAGAACAAGCAAGCAGTTTTGATTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KH_1 zf-CCCH zf-CCCH_2

Protein Analysis

49

Amino Acids

5.39

Weight (kDa)

6.54

Isoelectric Point (pI)

30.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000725)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g16700
malus_domestica MD02G1307600.v1.1 MD03G1278800.v1.1 MD03G1279100.v1.1 MD03G1279600.v1.1 MD03G1280000.v1.1 MD03G1280200.v1.1 MD07G1008400.v1.1 MD07G1014900.v1.1 MD07G1015700.v1.1 MD07G1016100.v1.1 MD07G1016200.v1.1 MD07G1016500.v1.1 MD07G1016600.v1.1 MD07G1016700.v1.1 MD07G1017400.v1.1 MD07G1019600.v1.1 MD07G1019800.v1.1 MD07G1023700.v1.1 MD07G1024100.v1.1 MD07G1024300.v1.1 MD07G1024400.v1.1 MD14G1086900.v1.1 MD14G1087000.v1.1 MD16G1179200.v1.1 MD17G1030800.v1.1
prunus_persica Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011400_v2.0.a1 Prupe.2G011500_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G014000_v2.0.a1 Prupe.2G014100_v2.0.a1
pyrus_communis pycom02g25880 pycom07g00690 pycom07g00720 pycom07g01130 pycom07g01140 pycom07g01150 pycom07g01160 pycom07g01260 pycom07g01280 pycom07g01300 pycom07g01320 pycom07g01550 pycom07g01790 pycom07g01810 pycom07g01840 pycom07g01850 pycom07g01870 pycom07g01880 pycom07g01890 pycom13g15290 pycom16g15040
rosa_chinensis RchiOBHm_Chr4g0420141
rosa_multiflora Rmu_sc0001252.1_g000002
rosa_roxburghii Rroxscaffold_1G00012760
rosa_rugosa Rorug04G0162600
rosa_samantha Rh4AG223400 Rh4BG225900 Rh4CG236600 Rh4DG222200
rosa_wichuraiana Rw4G019230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 24
AgsI TTSAA 1 cut(s) 146
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
AlwI GGATC 1 cut(s) 24
AoxI GGCC 1 cut(s) 3
BciVI GTATCC 1 cut(s) 55
BfuI GTATCC 1 cut(s) 55
Bse1I ACTGG 1 cut(s) 97
BseNI ACTGG 1 cut(s) 97
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 16
BspANI GGCC 1 cut(s) 5
BspPI GGATC 1 cut(s) 24
BsrI ACTGG 1 cut(s) 97
BssMI GATC 1 cut(s) 16
BstC8I GCNNGC 1 cut(s) 132
BstKTI GATC 1 cut(s) 19
BstMBI GATC 1 cut(s) 16
BstX2I RGATCY 1 cut(s) 16
BstYI RGATCY 1 cut(s) 16
BsuI GTATCC 1 cut(s) 55
BsuRI GGCC 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 132
CviAII CATG 1 cut(s) 101
CviJI RGCY 4 cut(s) 5, 89, 96, 114
CviKI_1 RGCY 4 cut(s) 5, 89, 96, 114
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
Eco32I GATATC 1 cut(s) 37
EcoRV GATATC 1 cut(s) 37
FaeI CATG 1 cut(s) 104
FaiI YATR 1 cut(s) 102
FatI CATG 1 cut(s) 100
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 34
Hpy8I GTNNAC 1 cut(s) 71
Hsp92II CATG 1 cut(s) 104
Kzo9I GATC 1 cut(s) 16
LpnPI CCDG 1 cut(s) 78
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MboII GAAGA 1 cut(s) 133
MflI RGATCY 1 cut(s) 16
MnlI CCTC 4 cut(s) 7, 16, 72, 104
MseI TTAA 1 cut(s) 117
MslI CAYNNNNRTG 1 cut(s) 105
NdeII GATC 1 cut(s) 16
NlaIII CATG 1 cut(s) 104
PsuI RGATCY 1 cut(s) 16
RseI CAYNNNNRTG 1 cut(s) 105
SaqAI TTAA 1 cut(s) 117
Sau3AI GATC 1 cut(s) 16
SetI ASST 1 cut(s) 91
SgeI CNNG 7 cut(s) 25, 78, 86, 105, 113, 139, 143
SmiMI CAYNNNNRTG 1 cut(s) 105
SspI AATATT 1 cut(s) 27
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspDTI ATGAA 2 cut(s) 89, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.