MD07G1094200.v1.1

eukaryotic translation initiation factor

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
10098292 .. 10098537
246 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1094200.v1.1.491

Sequence Viewer

Length: 150 bp
ATGCAAAGAAATAATTCTGATGCCAACAGGTGGCAGAGAGATACGAATTTTCAACCTAAGGGCTTGATGGCTTCTCCTCATGCTCCATTACAGGTGATGCACAAAGCTGACAGGAAGTATGAAATGGGTAAAGTGAGTGATGAAGAGTAG

Protein Analysis

50

Amino Acids

5.74

Weight (kDa)

8.18

Isoelectric Point (pI)

50.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 30
AcsI RAATTY 1 cut(s) 46
AfiI CCNNNNNNNGG 1 cut(s) 30
AgsI TTSAA 1 cut(s) 53
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
ApoI RAATTY 1 cut(s) 46
Asp700I GAANNNNTTC 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 106
AxyI CCTNAGG 1 cut(s) 57
BccI CCATC 1 cut(s) 61
BmsI GCATC 2 cut(s) 10, 87
Bsc4I CCNNNNNNNGG 1 cut(s) 30
Bse21I CCTNAGG 1 cut(s) 57
BseLI CCNNNNNNNGG 1 cut(s) 30
BseRI GAGGAG 1 cut(s) 66
BslI CCNNNNNNNGG 1 cut(s) 30
Bst6I CTCTTC 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 57
Bsu36I CCTNAGG 1 cut(s) 57
CviAII CATG 1 cut(s) 80
CviJI RGCY 3 cut(s) 63, 71, 107
CviKI_1 RGCY 3 cut(s) 63, 71, 107
DdeI CTNAG 1 cut(s) 57
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
Eco81I CCTNAGG 1 cut(s) 57
FaeI CATG 1 cut(s) 83
FaiI YATR 2 cut(s) 81, 120
FatI CATG 1 cut(s) 79
Hin1II CATG 1 cut(s) 83
HphI GGTGA 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 19
HpyCH4V TGCA 2 cut(s) 4, 100
HpyF3I CTNAG 1 cut(s) 57
Hsp92II CATG 1 cut(s) 83
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 3 cut(s) 13, 77, 97
LweI GCATC 2 cut(s) 10, 87
MluCI AATT 2 cut(s) 13, 46
MnlI CCTC 1 cut(s) 87
MroXI GAANNNNTTC 1 cut(s) 13
NlaIII CATG 1 cut(s) 83
PdmI GAANNNNTTC 1 cut(s) 13
PflMI CCANNNNNTGG 1 cut(s) 30
SetI ASST 4 cut(s) 32, 58, 96, 109
SfaNI GCATC 2 cut(s) 10, 87
SgeI CNNG 5 cut(s) 40, 76, 92, 104, 124
Sse9I AATT 2 cut(s) 13, 46
TasI AATT 2 cut(s) 13, 46
TspDTI ATGAA 1 cut(s) 135
Van91I CCANNNNNTGG 1 cut(s) 30
XapI RAATTY 1 cut(s) 46
XmnI GAANNNNTTC 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.