Rh5CG294400

eukaryotic translation initiation factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
32453274 .. 32453686
413 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG294400.1

Sequence Viewer

Length: 219 bp
ATGAGGGCAATCTATGGGAATGTAGCCACTGTAAATCCTTTGGATCCTGGTAGTGCTTCTACACATCAAAATGTCGCCCATGTACAGTCGCAATTTCATGAAGCATTGGAGACAATTGTTACAACCACAGCTCCCAAGCAAACAGAACCATCAGTTGCACCGAGAAGCTCTCAAGCTGTTCCAATAGCTCCAGCTCCAGCTTCTCAGTCTGCCTCCTGA

Protein Analysis

72

Amino Acids

7.42

Weight (kDa)

6.23

Isoelectric Point (pI)

59.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 38, 51
AfaI GTAC 1 cut(s) 84
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 6 cut(s) 131, 168, 176, 188, 194, 200
AluI AGCT 6 cut(s) 131, 168, 176, 188, 194, 200
Alw26I GTCTC 1 cut(s) 104
AlwI GGATC 2 cut(s) 38, 51
BamHI GGATCC 1 cut(s) 43
BccI CCATC 1 cut(s) 157
BciT130I CCWGG 1 cut(s) 48
BcoDI GTCTC 1 cut(s) 104
Bme1390I CCNGG 1 cut(s) 48
BmiI GGNNCC 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 48
BplI GAGNNNNNCTC 2 cut(s) 154, 186
BpmI CTGGAG 2 cut(s) 174, 180
BpuEI CTTGAG 1 cut(s) 156
BsaXI ACNNNNNCTCC 2 cut(s) 115, 145
BseBI CCWGG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 218
BsmAI GTCTC 1 cut(s) 104
Bsp1407I TGTACA 1 cut(s) 82
Bsp143I GATC 1 cut(s) 43
BspCNI CTCAG 1 cut(s) 217
BspHI TCATGA 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 45
BspPI GGATC 2 cut(s) 38, 51
BsrGI TGTACA 1 cut(s) 82
BssMI GATC 1 cut(s) 43
Bst2UI CCWGG 1 cut(s) 48
Bst4CI ACNGT 2 cut(s) 31, 87
BstAUI TGTACA 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 204
BstKTI GATC 1 cut(s) 46
BstMAI GTCTC 1 cut(s) 104
BstMBI GATC 1 cut(s) 43
BstNI CCWGG 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 46
BstX2I RGATCY 1 cut(s) 43
BstYI RGATCY 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 27
CciI TCATGA 1 cut(s) 97
Csp6I GTAC 1 cut(s) 83
CviAII CATG 2 cut(s) 80, 98
CviJI RGCY 7 cut(s) 26, 131, 168, 176, 188, 194, 200
CviKI_1 RGCY 7 cut(s) 26, 131, 168, 176, 188, 194, 200
CviQI GTAC 1 cut(s) 83
DdeI CTNAG 1 cut(s) 204
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
EcoRII CCWGG 1 cut(s) 46
FaeI CATG 2 cut(s) 83, 101
FaiI YATR 3 cut(s) 15, 81, 99
FatI CATG 2 cut(s) 79, 97
GsuI CTGGAG 2 cut(s) 174, 180
Hin1II CATG 2 cut(s) 83, 101
Hpy188III TCNNGA 2 cut(s) 98, 216
HpyCH4III ACNGT 2 cut(s) 31, 87
HpyCH4V TGCA 1 cut(s) 158
HpyF3I CTNAG 1 cut(s) 204
Hsp92II CATG 2 cut(s) 83, 101
Kzo9I GATC 1 cut(s) 43
LmnI GCTCC 3 cut(s) 136, 193, 199
LpnPI CCDG 4 cut(s) 33, 60, 204, 210
MaeIII GTNAC 1 cut(s) 118
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MfeI CAATTG 1 cut(s) 114
MflI RGATCY 1 cut(s) 43
MluCI AATT 2 cut(s) 92, 114
MslI CAYNNNNRTG 1 cut(s) 69
MspR9I CCNGG 1 cut(s) 48
MunI CAATTG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 48
NdeII GATC 1 cut(s) 43
NlaIII CATG 2 cut(s) 83, 101
NlaIV GGNNCC 1 cut(s) 45
PagI TCATGA 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PspN4I GGNNCC 1 cut(s) 45
PsuI RGATCY 1 cut(s) 43
RsaI GTAC 1 cut(s) 84
RsaNI GTAC 1 cut(s) 83
RseI CAYNNNNRTG 1 cut(s) 69
Sau3AI GATC 1 cut(s) 43
ScrFI CCNGG 1 cut(s) 48
SetI ASST 6 cut(s) 133, 170, 178, 190, 196, 202
SgeI CNNG 9 cut(s) 59, 60, 92, 110, 148, 174, 185, 203, 209
SmiMI CAYNNNNRTG 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 171
SmoI CTYRAG 1 cut(s) 171
Sse9I AATT 2 cut(s) 92, 114
StyD4I CCNGG 1 cut(s) 46
TaaI ACNGT 2 cut(s) 31, 87
TasI AATT 2 cut(s) 92, 114
TatI WGTACW 1 cut(s) 82
TscAI CASTG 1 cut(s) 34
TspDTI ATGAA 2 cut(s) 86, 114
TspRI CASTG 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.