Rh5CG294500

eukaryotic translation initiation factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0000945
Physical Location & Seq
Forward (+)
32454880 .. 32455296
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG294500.1

Sequence Viewer

Length: 417 bp
ATGCAGCTTCCTGGAGTTATGCATCAAAAAGTGAACCTGAGTTTTACCCCCCAAACGGGTCCTCAGCTTCCTCAGTTGGGCAACTTGGGGATCAGCATAGCTGCACAATACCCCCAACAGCAAGGTGGAAAGTTTGCTGGCCCTCGTAAAACTCCTGTCAAGATTACACATCCAGATACACATGAAGAGTTAAGGCTTGATAAACGGGCAGATTCATATCCAGATGGTGGCTCATCAGCCGCCAGGACTTACCCCAATGTTTCTCAATCCCAGCCCATGCCTTCGTTTGCTAGTTCTCATCCTACAAGCTATTATACCAATCCTAATCCCCTGTTTTTTCCATCTCTGAATTCACATCCTTTAACAAGTAGTCACAAGTCACCCAATTCACAAGCACCAGATTTAGCTATCCAGTGA

Protein Analysis

138

Amino Acids

14.96

Weight (kDa)

9.35

Isoelectric Point (pI)

53.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 227
AciI CCGC 1 cut(s) 240
AclWI GGATC 1 cut(s) 98
AcsI RAATTY 1 cut(s) 349
AfiI CCNNNNNNNGG 4 cut(s) 55, 56, 77, 227
AjnI CCWGG 2 cut(s) 10, 242
AluBI AGCT 5 cut(s) 7, 67, 101, 309, 407
AluI AGCT 5 cut(s) 7, 67, 101, 309, 407
AlwI GGATC 1 cut(s) 98
AoxI GGCC 1 cut(s) 139
ApeKI GCWGC 2 cut(s) 4, 101
ApoI RAATTY 1 cut(s) 349
AspS9I GGNCC 2 cut(s) 59, 140
AsuHPI GGTGA 1 cut(s) 372
AvaII GGWCC 1 cut(s) 59
BbvCI CCTCAGC 1 cut(s) 63
BbvI GCAGC 2 cut(s) 16, 88
BccI CCATC 2 cut(s) 218, 349
BciT130I CCWGG 2 cut(s) 12, 244
BfaI CTAG 1 cut(s) 291
BisI GCNGC 3 cut(s) 5, 102, 240
BlsI GCNGC 3 cut(s) 6, 103, 241
Bme1390I CCNGG 2 cut(s) 12, 244
Bme18I GGWCC 1 cut(s) 59
BmgT120I GGNCC 2 cut(s) 59, 140
BmiI GGNNCC 1 cut(s) 60
BmrFI CCNGG 2 cut(s) 12, 244
BmsI GCATC 1 cut(s) 31
BpmI CTGGAG 1 cut(s) 33
Bpu10I CCTNAGC 1 cut(s) 63
BsaBI GATNNNNATC 1 cut(s) 216
Bsc4I CCNNNNNNNGG 4 cut(s) 55, 56, 77, 227
Bse1I ACTGG 1 cut(s) 412
Bse8I GATNNNNATC 1 cut(s) 216
BseBI CCWGG 2 cut(s) 12, 244
BseGI GGATG 3 cut(s) 169, 298, 355
BseJI GATNNNNATC 1 cut(s) 216
BseLI CCNNNNNNNGG 4 cut(s) 55, 56, 77, 227
BseMII CTCAG 3 cut(s) 29, 77, 86
BseNI ACTGG 1 cut(s) 412
BseXI GCAGC 2 cut(s) 16, 88
BseYI CCCAGC 1 cut(s) 270
BsgI GTGCAG 1 cut(s) 87
BshFI GGCC 1 cut(s) 141
BslI CCNNNNNNNGG 4 cut(s) 55, 56, 77, 227
BsnI GGCC 1 cut(s) 141
Bsp143I GATC 1 cut(s) 90
BspACI CCGC 1 cut(s) 240
BspANI GGCC 1 cut(s) 141
BspCNI CTCAG 3 cut(s) 30, 76, 85
BspLI GGNNCC 1 cut(s) 60
BspPI GGATC 1 cut(s) 98
BsrI ACTGG 1 cut(s) 412
BssMI GATC 1 cut(s) 90
Bst2UI CCWGG 2 cut(s) 12, 244
Bst6I CTCTTC 1 cut(s) 180
BstC8I GCNNGC 1 cut(s) 139
BstDEI CTNAG 3 cut(s) 38, 63, 72
BstF5I GGATG 3 cut(s) 169, 298, 355
BstKTI GATC 1 cut(s) 93
BstMBI GATC 1 cut(s) 90
BstNI CCWGG 2 cut(s) 12, 244
BstSCI CCNGG 2 cut(s) 10, 242
BstV1I GCAGC 2 cut(s) 16, 88
BsuRI GGCC 1 cut(s) 141
BtsCI GGATG 3 cut(s) 169, 298, 355
Cac8I GCNNGC 1 cut(s) 139
Cfr13I GGNCC 2 cut(s) 59, 140
CviAII CATG 2 cut(s) 182, 277
DdeI CTNAG 3 cut(s) 38, 63, 72
DpnI GATC 1 cut(s) 92
DpnII GATC 1 cut(s) 90
Eam1104I CTCTTC 1 cut(s) 180
EarI CTCTTC 1 cut(s) 180
Eco47I GGWCC 1 cut(s) 59
EcoO109I RGGNCCY 1 cut(s) 59
EcoRI GAATTC 1 cut(s) 349
EcoRII CCWGG 2 cut(s) 10, 242
EcoT22I ATGCAT 1 cut(s) 24
FaeI CATG 2 cut(s) 185, 280
FaiI YATR 6 cut(s) 20, 98, 183, 217, 278, 315
FatI CATG 2 cut(s) 181, 276
Fnu4HI GCNGC 3 cut(s) 5, 102, 240
FokI GGATG 3 cut(s) 156, 285, 342
Fsp4HI GCNGC 3 cut(s) 5, 102, 240
FspBI CTAG 1 cut(s) 291
GluI GCNGC 3 cut(s) 5, 102, 240
GsaI CCCAGC 1 cut(s) 274
GsuI CTGGAG 1 cut(s) 33
HaeIII GGCC 1 cut(s) 141
Hin1II CATG 2 cut(s) 185, 280
HinfI GANTC 1 cut(s) 212
HphI GGTGA 1 cut(s) 372
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 348
Hpy188III TCNNGA 3 cut(s) 160, 173, 221
Hpy8I GTNNAC 1 cut(s) 34
HpyAV CCTTC 1 cut(s) 291
HpyCH4V TGCA 3 cut(s) 4, 22, 104
HpyF3I CTNAG 3 cut(s) 38, 63, 72
Hsp92II CATG 2 cut(s) 185, 280
Kzo9I GATC 1 cut(s) 90
Lsp1109I GCAGC 2 cut(s) 16, 88
LweI GCATC 1 cut(s) 31
MaeI CTAG 1 cut(s) 291
MaeIII GTNAC 2 cut(s) 371, 378
MalI GATC 1 cut(s) 92
MboI GATC 1 cut(s) 90
MboII GAAGA 1 cut(s) 197
MluCI AATT 2 cut(s) 349, 385
MnlI CCTC 3 cut(s) 72, 81, 153
Mph1103I ATGCAT 1 cut(s) 24
MseI TTAA 2 cut(s) 191, 362
MspR9I CCNGG 2 cut(s) 12, 244
MvaI CCWGG 2 cut(s) 12, 244
NdeII GATC 1 cut(s) 90
NlaIII CATG 2 cut(s) 185, 280
NlaIV GGNNCC 1 cut(s) 60
NmuCI GTSAC 2 cut(s) 371, 378
NsiI ATGCAT 1 cut(s) 24
PfeI GAWTC 1 cut(s) 212
PflMI CCANNNNNTGG 1 cut(s) 227
PfoI TCCNGGA 1 cut(s) 10
PkrI GCNGC 3 cut(s) 6, 103, 241
PpuMI RGGWCCY 1 cut(s) 59
Psp5II RGGWCCY 1 cut(s) 59
Psp6I CCWGG 2 cut(s) 10, 242
PspFI CCCAGC 1 cut(s) 270
PspGI CCWGG 2 cut(s) 10, 242
PspN4I GGNNCC 1 cut(s) 60
PspPI GGNCC 2 cut(s) 59, 140
PspPPI RGGWCCY 1 cut(s) 59
SaqAI TTAA 2 cut(s) 191, 362
SatI GCNGC 3 cut(s) 5, 102, 240
Sau3AI GATC 1 cut(s) 90
Sau96I GGNCC 2 cut(s) 59, 140
ScrFI CCNGG 2 cut(s) 12, 244
SetI ASST 7 cut(s) 9, 39, 69, 103, 127, 311, 409
SfaNI GCATC 1 cut(s) 31
SinI GGWCC 1 cut(s) 59
Sse9I AATT 2 cut(s) 349, 385
SsiI CCGC 1 cut(s) 240
SspMI CTAG 1 cut(s) 291
StyD4I CCNGG 2 cut(s) 10, 242
TasI AATT 2 cut(s) 349, 385
TauI GCSGC 1 cut(s) 242
TfiI GAWTC 1 cut(s) 212
Tru1I TTAA 2 cut(s) 191, 362
Tru9I TTAA 2 cut(s) 191, 362
TseFI GTSAC 2 cut(s) 371, 378
TseI GCWGC 2 cut(s) 4, 101
Tsp45I GTSAC 2 cut(s) 371, 378
TspDTI ATGAA 2 cut(s) 198, 204
Van91I CCANNNNNTGG 1 cut(s) 227
VpaK11BI GGWCC 1 cut(s) 59
XapI RAATTY 1 cut(s) 349
XcmI CCANNNNNNNNNTGG 1 cut(s) 122
XspI CTAG 1 cut(s) 291
Zsp2I ATGCAT 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.