MD09G1090100.v1.1
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0001688
Physical Location & Seq
Forward (+)
6581530 .. 6581781
252 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1090100.v1.1.491

Sequence Viewer

Length: 252 bp
ATGTTTGGTTTTGCTGATTCCATGGCCTTAAAATGTGCTGTGGAGCTATGCATTGCCGATATCATACACTCCCATAGTCCTACTGAGCCTATGATCACTTTGTCCCAATTAGCCTCATCCATAGCACCTTCTCCAGACATGACGTACCTCACAATCATCATGAGACTTCTTGTCTGTCAGAATATATTTGCCATTCATCACCCATCTGATGGTGGGGAACCACTTTATGGGTTGACACACTCATCAAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

84

Amino Acids

9.02

Weight (kDa)

5.54

Isoelectric Point (pI)

47.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dimerisation PF08100 1 - 83 3.2e-16 O-methyltransferase dimerisation domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 209, 227
AfaI GTAC 1 cut(s) 146
AfiI CCNNNNNNNGG 2 cut(s) 209, 227
AhdI GACNNNNNGTC 1 cut(s) 170
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
Alw26I GTCTC 1 cut(s) 157
AoxI GGCC 1 cut(s) 24
AsuHPI GGTGA 1 cut(s) 191
BccI CCATC 2 cut(s) 203, 211
BclI TGATCA 1 cut(s) 93
BcoDI GTCTC 1 cut(s) 157
BmeRI GACNNNNNGTC 1 cut(s) 170
BmiI GGNNCC 1 cut(s) 219
BpmI CTGGAG 1 cut(s) 117
BsaJI CCNNGG 1 cut(s) 21
Bsc4I CCNNNNNNNGG 2 cut(s) 209, 227
Bse3DI GCAATG 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 116
BseLI CCNNNNNNNGG 2 cut(s) 209, 227
BseMI GCAATG 1 cut(s) 51
BseMII CTCAG 1 cut(s) 75
BshFI GGCC 1 cut(s) 26
BslFI GGGAC 1 cut(s) 88
BslI CCNNNNNNNGG 2 cut(s) 209, 227
BsmAI GTCTC 1 cut(s) 157
BsmFI GGGAC 1 cut(s) 88
BsnI GGCC 1 cut(s) 26
Bsp143I GATC 1 cut(s) 93
Bsp19I CCATGG 1 cut(s) 21
BspANI GGCC 1 cut(s) 26
BspCNI CTCAG 1 cut(s) 76
BspHI TCATGA 1 cut(s) 159
BspLI GGNNCC 1 cut(s) 219
BsrDI GCAATG 1 cut(s) 51
BssECI CCNNGG 1 cut(s) 21
BssMI GATC 1 cut(s) 93
BssT1I CCWWGG 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 84
BstDSI CCRYGG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 116
BstKTI GATC 1 cut(s) 96
BstMAI GTCTC 1 cut(s) 157
BstMBI GATC 1 cut(s) 93
BsuRI GGCC 1 cut(s) 26
BtgI CCRYGG 1 cut(s) 21
BtsCI GGATG 1 cut(s) 116
CciI TCATGA 1 cut(s) 159
Csp6I GTAC 1 cut(s) 145
CviAII CATG 3 cut(s) 22, 139, 160
CviJI RGCY 4 cut(s) 26, 46, 88, 113
CviKI_1 RGCY 4 cut(s) 26, 46, 88, 113
CviQI GTAC 1 cut(s) 145
DdeI CTNAG 1 cut(s) 84
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
DriI GACNNNNNGTC 1 cut(s) 170
Eam1105I GACNNNNNGTC 1 cut(s) 170
Eco130I CCWWGG 1 cut(s) 21
Eco32I GATATC 1 cut(s) 61
EcoRV GATATC 1 cut(s) 61
EcoT14I CCWWGG 1 cut(s) 21
EcoT22I ATGCAT 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 21
FaeI CATG 3 cut(s) 25, 142, 163
FaqI GGGAC 1 cut(s) 88
FatI CATG 3 cut(s) 21, 138, 159
FbaI TGATCA 1 cut(s) 93
FokI GGATG 1 cut(s) 103
GsuI CTGGAG 1 cut(s) 117
HaeIII GGCC 1 cut(s) 26
Hin1II CATG 3 cut(s) 25, 142, 163
HincII GTYRAC 1 cut(s) 234
HindII GTYRAC 1 cut(s) 234
HinfI GANTC 1 cut(s) 17
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 234
Hpy188I TCNGA 2 cut(s) 180, 208
Hpy188III TCNNGA 3 cut(s) 134, 160, 246
Hpy8I GTNNAC 1 cut(s) 234
HpyAV CCTTC 1 cut(s) 138
HpyCH4IV ACGT 1 cut(s) 143
HpyCH4V TGCA 1 cut(s) 51
HpyF3I CTNAG 1 cut(s) 84
HpySE526I ACGT 1 cut(s) 143
Hsp92II CATG 3 cut(s) 25, 142, 163
Ksp22I TGATCA 1 cut(s) 93
Kzo9I GATC 1 cut(s) 93
LmnI GCTCC 1 cut(s) 43
LpnPI CCDG 1 cut(s) 147
MaeII ACGT 1 cut(s) 143
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MluCI AATT 1 cut(s) 107
MnlI CCTC 2 cut(s) 124, 158
Mph1103I ATGCAT 1 cut(s) 53
MseI TTAA 1 cut(s) 29
NcoI CCATGG 1 cut(s) 21
NdeII GATC 1 cut(s) 93
NlaIII CATG 3 cut(s) 25, 142, 163
NlaIV GGNNCC 1 cut(s) 219
NsiI ATGCAT 1 cut(s) 53
PagI TCATGA 1 cut(s) 159
PfeI GAWTC 1 cut(s) 17
PflMI CCANNNNNTGG 2 cut(s) 209, 227
PspN4I GGNNCC 1 cut(s) 219
RsaI GTAC 1 cut(s) 146
RsaNI GTAC 1 cut(s) 145
SaqAI TTAA 1 cut(s) 29
Sau3AI GATC 1 cut(s) 93
SetI ASST 4 cut(s) 48, 130, 146, 150
SgeI CNNG 5 cut(s) 34, 146, 151, 172, 182
Sse9I AATT 1 cut(s) 107
StyI CCWWGG 1 cut(s) 21
TaiI ACGT 1 cut(s) 146
TasI AATT 1 cut(s) 107
TfiI GAWTC 1 cut(s) 17
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 185
Van91I CCANNNNNTGG 2 cut(s) 209, 227
Zsp2I ATGCAT 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.