Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001803.1

Orthogroup ID

OG0001688

Physical Location & Seq

Genomic Coordinates Forward (+)

109328 .. 110502

Gene Structure 1175 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001803.1_g000030.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1080 bp

atggaagcagttacagaattggatgaagcaactctaagaggccaagcagatgtatggaagtacatgctcggctttgcagattccatggctttgaaatctgttgtggagctccgcataccagatatcatacactctcatggtcatgcattgactttgtctgaaatagcctcatccatcgatgttgcatcaccctctccagatatcacatgcctctctcggatcatgcggttgctggtccgcagaaacatcttcacctcacatcatggcggtggagattctggagaaaccctctacgggttgactccttcgtctagatggctcttgtatgactcggagctcactctcgctccgatggttctctcggagacaaatcctattctaatggctccaatgcactatttcagccaatgcgtcaagcaaggtggcccatgtgcctttgagaaagcgcatgggcgcgaaattgtgcaattcttctccgaaaaccttgagatcaaccgattgttcaacgatgccatggcgtgtacctctaagattataatgaaagtgatacttgccaaatataagggtgggtttgatgacgtggcaaaactggtggatgttggtggtggtacaggaaccgctgtggcggagattgtgaaggcgtatcccatcattaacgggatcaactttgatctaccatatggggttgcaacagcaccggcttaccatggggtgtcacatgtcggaggtgacatgtttgatgagggcagtattccaaacgctgatgcaatttttatgaagtggattttgcacgactggagcgacagcgattgcatcaagatattgaacaactgtcggaaggcaataccggagagaagtggcaaggtgattattgtggacgttgttctggagccaaatggtgatggcatgttcgacgacacaggcgtagtttttgatctgctaatgattgctcataccacaggtggaaaggagaggagcgagagtgaatggaagaaaatgttggaacaagcaggcttccctcgctacaaaatcatcaaaattccagctttaccgtccattatcgaggcctaccctgtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Dimerisation Methyltransf_2

Protein Analysis

359

Amino Acids

39.34

Weight (kDa)

5.3

Isoelectric Point (pI)

43.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001688)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g17220 FvH4_6g45070
malus_domestica	MD09G1089200.v1.1 MD09G1089800.v1.1 MD09G1090100.v1.1 MD09G1090200.v1.1 MD17G1079200.v1.1
prunus_persica	Prupe.3G235300_v2.0.a1 Prupe.3G235500_v2.0.a1
pyrus_communis	pycom09g01490 pycom17g07830
rosa_chinensis	RchiOBHm_Chr1g0324661 RchiOBHm_Chr2g0139131 RchiOBHm_Chr4g0427641 RchiOBHm_Chr4g0427651
rosa_laevigata	RLG00000007219 RLG00000007220 RLG00000019790 RLG00000021346 RLG00000021347
rosa_multiflora	Rmu_co8132516.1_g000001 Rmu_sc0001803.1_g000030 Rmu_sc0003399.1_g000006 Rmu_sc0009627.1_g000012 Rmu_sc0009627.1_g000013
rosa_roxburghii	Rroxscaffold_2G00105640 Rroxscaffold_5G00369270 Rroxscaffold_5G00369300
rosa_rugosa	Rorug02G0354700 Rorug02G0498000 Rorug04G0219000
rosa_samantha	Rh1CG065100 Rh1DG069400 Rh1DG070200 Rh2AG405100 Rh2BG415000 Rh2CG391300 Rh2DG424900 Rh4AG275500 Rh4BG281400 Rh4BG281500 Rh4CG296800 Rh4CG296900 Rh4DG278800 Rh4DG278900
rosa_wichuraiana	Rw1G005480 Rw2G033080 Rw4G023890 Rw4G023900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	536
AasI	GACNNNNNNGTC	1 cut(s)	307
AccII	CGCG	1 cut(s)	456
AciI	CCGC	6 cut(s)	112, 226, 238, 267, 618, 626
AclWI	GGATC	2 cut(s)	227, 668
AcsI	RAATTY	1 cut(s)	1038
AfaI	GTAC	3 cut(s)	62, 523, 610
AfiI	CCNNNNNNNGG	1 cut(s)	294
AflIII	ACRYGT	2 cut(s)	718, 732
AgsI	TTSAA	3 cut(s)	94, 505, 826
AjiI	CACGTC	1 cut(s)	580
AjuI	GAANNNNNNNTTGG	2 cut(s)	983, 1015
AluBI	AGCT	3 cut(s)	109, 337, 1046
AluI	AGCT	3 cut(s)	109, 337, 1046
Alw21I	GWGCWC	2 cut(s)	111, 339
Alw26I	GTCTC	1 cut(s)	359
AlwI	GGATC	2 cut(s)	227, 668
AoxI	GGCC	3 cut(s)	40, 424, 1065
ApoI	RAATTY	1 cut(s)	1038
AspLEI	GCGC	2 cut(s)	448, 456
AspS9I	GGNCC	2 cut(s)	235, 425
AsuHPI	GGTGA	5 cut(s)	180, 244, 740, 877, 911
AvaII	GGWCC	1 cut(s)	235
BanII	GRGCYC	2 cut(s)	111, 339
Bbv12I	GWGCWC	2 cut(s)	111, 339
BccI	CCATC	5 cut(s)	182, 309, 346, 656, 896
BciVI	GTATCC	1 cut(s)	654
BcoDI	GTCTC	1 cut(s)	359
BfaI	CTAG	1 cut(s)	312
BfuI	GTATCC	1 cut(s)	654
Bme18I	GGWCC	1 cut(s)	235
BmgBI	CACGTC	1 cut(s)	580
BmgT120I	GGNCC	2 cut(s)	235, 425
BmiI	GGNNCC	3 cut(s)	387, 616, 891
BmsI	GCATC	4 cut(s)	194, 499, 754, 822
BplI	GAGNNNNNCTC	2 cut(s)	273, 305
BpmI	CTGGAG	4 cut(s)	180, 300, 817, 908
BpuEI	CTTGAG	1 cut(s)	506
Bsa29I	ATCGAT	1 cut(s)	177
BsaJI	CCNNGG	3 cut(s)	84, 513, 706
BsaWI	WCCGGW	1 cut(s)	847
BsaXI	ACNNNNNCTCC	4 cut(s)	331, 361, 967, 997
Bsc4I	CCNNNNNNNGG	1 cut(s)	294
Bse118I	RCCGGY	1 cut(s)	697
Bse1I	ACTGG	2 cut(s)	594, 800
BseCI	ATCGAT	1 cut(s)	177
BseDI	CCNNGG	3 cut(s)	84, 513, 706
BseGI	GGATG	3 cut(s)	28, 170, 601
BseLI	CCNNNNNNNGG	1 cut(s)	294
BseNI	ACTGG	2 cut(s)	594, 800
BseRI	GAGGAG	1 cut(s)	988
Bsh1236I	CGCG	1 cut(s)	456
BshFI	GGCC	3 cut(s)	42, 426, 1067
BshVI	ATCGAT	1 cut(s)	177
BsiHKAI	GWGCWC	2 cut(s)	111, 339
BsiSI	CCGG	2 cut(s)	698, 848
BslI	CCNNNNNNNGG	1 cut(s)	294
BsmAI	GTCTC	1 cut(s)	359
BsnI	GGCC	3 cut(s)	42, 426, 1067
Bsp1286I	GDGCHC	2 cut(s)	111, 339
Bsp143I	GATC	5 cut(s)	219, 489, 660, 670, 934
Bsp19I	CCATGG	3 cut(s)	84, 513, 706
BspACI	CCGC	6 cut(s)	112, 226, 238, 267, 618, 626
BspANI	GGCC	3 cut(s)	42, 426, 1067
BspDI	ATCGAT	1 cut(s)	177
BspFNI	CGCG	1 cut(s)	456
BspLI	GGNNCC	3 cut(s)	387, 616, 891
BspPI	GGATC	2 cut(s)	227, 668
BsrFI	RCCGGY	1 cut(s)	697
BsrI	ACTGG	2 cut(s)	594, 800
BssAI	RCCGGY	1 cut(s)	697
BssECI	CCNNGG	3 cut(s)	84, 513, 706
BssMI	GATC	5 cut(s)	219, 489, 660, 670, 934
BssT1I	CCWWGG	3 cut(s)	84, 513, 706
Bst4CI	ACNGT	2 cut(s)	833, 1053
BstC8I	GCNNGC	1 cut(s)	1012
BstDEI	CTNAG	2 cut(s)	35, 528
BstDSI	CCRYGG	3 cut(s)	84, 513, 706
BstF5I	GGATG	3 cut(s)	28, 170, 601
BstFNI	CGCG	1 cut(s)	456
BstHHI	GCGC	2 cut(s)	448, 456
BstKTI	GATC	5 cut(s)	222, 492, 663, 673, 937
BstMAI	GTCTC	1 cut(s)	359
BstMBI	GATC	5 cut(s)	219, 489, 660, 670, 934
BstMWI	GCNNNNNNNGC	1 cut(s)	1020
BstNSI	RCATGY	5 cut(s)	67, 210, 722, 736, 910
BstUI	CGCG	1 cut(s)	456
Bsu15I	ATCGAT	1 cut(s)	177
BsuI	GTATCC	1 cut(s)	654
BsuRI	GGCC	3 cut(s)	42, 426, 1067
BsuTUI	ATCGAT	1 cut(s)	177
BtgI	CCRYGG	3 cut(s)	84, 513, 706
BtrI	CACGTC	1 cut(s)	580
BtsCI	GGATG	3 cut(s)	28, 170, 601
Cac8I	GCNNGC	1 cut(s)	1012
CfoI	GCGC	2 cut(s)	448, 456
Cfr10I	RCCGGY	1 cut(s)	697
Cfr13I	GGNCC	2 cut(s)	235, 425
ClaI	ATCGAT	1 cut(s)	177
CseI	GACGC	1 cut(s)	400
Csp6I	GTAC	3 cut(s)	61, 522, 609
CspCI	CAANNNNNGTGG	4 cut(s)	403, 438, 573, 608
CviQI	GTAC	3 cut(s)	61, 522, 609
DdeI	CTNAG	2 cut(s)	35, 528
DpnI	GATC	5 cut(s)	221, 491, 662, 672, 936
DpnII	GATC	5 cut(s)	219, 489, 660, 670, 934
DrdI	GACNNNNNNGTC	1 cut(s)	307
DseDI	GACNNNNNNGTC	1 cut(s)	307
EciI	GGCGGA	1 cut(s)	641
Ecl136II	GAGCTC	2 cut(s)	109, 337
Eco130I	CCWWGG	3 cut(s)	84, 513, 706
Eco147I	AGGCCT	1 cut(s)	1067
Eco24I	GRGCYC	2 cut(s)	111, 339
Eco32I	GATATC	2 cut(s)	124, 202
Eco47I	GGWCC	1 cut(s)	235
Eco53kI	GAGCTC	2 cut(s)	109, 337
EcoICRI	GAGCTC	2 cut(s)	109, 337
EcoRV	GATATC	2 cut(s)	124, 202
EcoT14I	CCWWGG	3 cut(s)	84, 513, 706
EcoT22I	ATGCAT	1 cut(s)	148
EcoT38I	GRGCYC	2 cut(s)	111, 339
ErhI	CCWWGG	3 cut(s)	84, 513, 706
FalI	AAGNNNNNCTT	2 cut(s)	534, 566
FauNDI	CATATG	1 cut(s)	679
FokI	GGATG	3 cut(s)	35, 157, 608
FriOI	GRGCYC	2 cut(s)	111, 339
FspBI	CTAG	1 cut(s)	312
GlaI	GCGC	2 cut(s)	447, 455
GsuI	CTGGAG	4 cut(s)	180, 300, 817, 908
HaeIII	GGCC	3 cut(s)	42, 426, 1067
HapII	CCGG	2 cut(s)	698, 848
HgaI	GACGC	1 cut(s)	400
HhaI	GCGC	2 cut(s)	448, 456
Hin6I	GCGC	2 cut(s)	446, 454
HinP1I	GCGC	2 cut(s)	446, 454
HincII	GTYRAC	1 cut(s)	300
HindII	GTYRAC	1 cut(s)	300
HinfI	GANTC	4 cut(s)	80, 275, 301, 329
HpaII	CCGG	2 cut(s)	698, 848
HphI	GGTGA	5 cut(s)	180, 244, 740, 877, 911
Hpy166II	GTNNAC	3 cut(s)	300, 522, 877
Hpy188I	TCNGA	8 cut(s)	160, 219, 334, 351, 364, 478, 725, 837
Hpy188III	TCNNGA	5 cut(s)	197, 279, 312, 817, 887
Hpy8I	GTNNAC	3 cut(s)	300, 522, 877
Hpy99I	CGWCG	1 cut(s)	917
HpyAV	CCTTC	3 cut(s)	315, 631, 832
HpyCH4III	ACNGT	2 cut(s)	833, 1053
HpyCH4IV	ACGT	2 cut(s)	579, 879
HpyCH4V	TGCA	9 cut(s)	77, 146, 185, 394, 466, 689, 767, 790, 813
HpyF10VI	GCNNNNNNNGC	1 cut(s)	1020
HpyF3I	CTNAG	2 cut(s)	35, 528
HpySE526I	ACGT	2 cut(s)	579, 879
HspAI	GCGC	2 cut(s)	446, 454
Kzo9I	GATC	5 cut(s)	219, 489, 660, 670, 934
LmnI	GCTCC	8 cut(s)	106, 114, 334, 352, 391, 798, 889, 975
LweI	GCATC	4 cut(s)	194, 499, 754, 822
MaeI	CTAG	1 cut(s)	312
MaeII	ACGT	2 cut(s)	579, 879
MaeIII	GTNAC	3 cut(s)	10, 714, 728
MalI	GATC	5 cut(s)	221, 491, 662, 672, 936
MboI	GATC	5 cut(s)	219, 489, 660, 670, 934
MboII	GAAGA	3 cut(s)	241, 463, 1003
MhlI	GDGCHC	2 cut(s)	111, 339
MluCI	AATT	5 cut(s)	17, 459, 467, 768, 1038
MlyI	GAGTC	2 cut(s)	295, 323
MmeI	TCCRAC	3 cut(s)	703, 815, 981
Mph1103I	ATGCAT	1 cut(s)	148
MseI	TTAA	1 cut(s)	654
MslI	CAYNNNNRTG	3 cut(s)	135, 141, 267
MspA1I	CMGCKG	1 cut(s)	620
MspI	CCGG	2 cut(s)	698, 848
MvnI	CGCG	1 cut(s)	456
MwoI	GCNNNNNNNGC	1 cut(s)	1020
NcoI	CCATGG	3 cut(s)	84, 513, 706
NdeI	CATATG	1 cut(s)	679
NdeII	GATC	5 cut(s)	219, 489, 660, 670, 934
NlaIV	GGNNCC	3 cut(s)	387, 616, 891
NmeAIII	GCCGAG	1 cut(s)	48
NmuCI	GTSAC	2 cut(s)	714, 728
NsiI	ATGCAT	1 cut(s)	148
NspI	RCATGY	5 cut(s)	67, 210, 722, 736, 910
PceI	AGGCCT	1 cut(s)	1067
PciI	ACATGT	2 cut(s)	718, 732
PcsI	WCGNNNNNNNCGW	2 cut(s)	798, 921
PfeI	GAWTC	2 cut(s)	80, 275
PflFI	GACNNNGTC	1 cut(s)	154
PleI	GAGTC	2 cut(s)	295, 323
PpsI	GAGTC	2 cut(s)	295, 323
PscI	ACATGT	2 cut(s)	718, 732
PsiI	TTATAA	1 cut(s)	536
Psp124BI	GAGCTC	2 cut(s)	111, 339
PspN4I	GGNNCC	3 cut(s)	387, 616, 891
PspPI	GGNCC	2 cut(s)	235, 425
PsyI	GACNNNGTC	1 cut(s)	154
RsaI	GTAC	3 cut(s)	62, 523, 610
RsaNI	GTAC	3 cut(s)	61, 522, 609
RseI	CAYNNNNRTG	3 cut(s)	135, 141, 267
SacI	GAGCTC	2 cut(s)	111, 339
SaqAI	TTAA	1 cut(s)	654
Sau3AI	GATC	5 cut(s)	219, 489, 660, 670, 934
Sau96I	GGNCC	2 cut(s)	235, 425
SchI	GAGTC	2 cut(s)	295, 323
SduI	GDGCHC	2 cut(s)	111, 339
SfaNI	GCATC	4 cut(s)	194, 499, 754, 822
SinI	GGWCC	1 cut(s)	235
SmiMI	CAYNNNNRTG	3 cut(s)	135, 141, 267
SmlI	CTYRAG	1 cut(s)	485
SmoI	CTYRAG	1 cut(s)	485
Sse9I	AATT	5 cut(s)	17, 459, 467, 768, 1038
SseBI	AGGCCT	1 cut(s)	1067
SsiI	CCGC	6 cut(s)	112, 226, 238, 267, 618, 626
SspMI	CTAG	1 cut(s)	312
SstI	GAGCTC	2 cut(s)	111, 339
StuI	AGGCCT	1 cut(s)	1067
StyI	CCWWGG	3 cut(s)	84, 513, 706
TaaI	ACNGT	2 cut(s)	833, 1053
TaiI	ACGT	2 cut(s)	582, 882
TaqI	TCGA	3 cut(s)	177, 912, 1062
TasI	AATT	5 cut(s)	17, 459, 467, 768, 1038
TatI	WGTACW	1 cut(s)	60
TfiI	GAWTC	2 cut(s)	80, 275
Tru1I	TTAA	1 cut(s)	654
Tru9I	TTAA	1 cut(s)	654
TseFI	GTSAC	2 cut(s)	714, 728
Tsp45I	GTSAC	2 cut(s)	714, 728
TspDTI	ATGAA	3 cut(s)	39, 554, 791
Tth111I	GACNNNGTC	1 cut(s)	154
VpaK11BI	GGWCC	1 cut(s)	235
XapI	RAATTY	1 cut(s)	1038
XbaI	TCTAGA	1 cut(s)	311
XceI	RCATGY	5 cut(s)	67, 210, 722, 736, 910
XspI	CTAG	1 cut(s)	312
Zsp2I	ATGCAT	1 cut(s)	148

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.