Prupe.2G115300_v2.0.a1

rRNA-processing protein EBP2 homolog

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
17304426 .. 17305119
694 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G115300.1

Sequence Viewer

Length: 483 bp
ATGGAAGAGGATGATTTGGAAGATGTTGTGTCTGAGCCAGAATCCGAACCAGAATATAGAGAGGAGGAAGATGTGAAATTGACTAAGCCTTCTAAGAATGTCTTTTACACGCAGGCTCTAGAGGGAGCAAGGAGGCTTGAAGACTACTATGCAAAAATGGTGAAGTTAGATTCTCACATGGAGAAACAAAATGGGTTTCCTGGGGGTGACAAAGGTAGTGAGTTGGATTTGGCCTTTGAAGATGGGAAGCCATTTGAGAAGTCAAGCAATAAGAGGCCAGGTGTGTCTCGTGGTGATCGGTTCAGTGGAAAGGCAAGACAAGGCGGGAAGGTGACGAAACCGAAGAAGAGAGAAATCAAGGATTCCAAGTTTGGATTTGGAGGGAGGAAAGGTTCTAAGAAGCAAAATGTAGCTGAAACAACCAATGATTTGAGAGGCTTCAATAGAGACACTCTCTCAAGAAATAAGAAAAGGAAGAGGTGA

Protein Analysis

161

Amino Acids

18.24

Weight (kDa)

9.35

Isoelectric Point (pI)

58.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 324
AgsI TTSAA 3 cut(s) 140, 239, 442
AjnI CCWGG 2 cut(s) 199, 277
AloI GAACNNNNNNTCC 2 cut(s) 376, 408
AluBI AGCT 1 cut(s) 413
AluI AGCT 1 cut(s) 413
Alw26I GTCTC 2 cut(s) 291, 441
AoxI GGCC 2 cut(s) 231, 275
AsuHPI GGTGA 4 cut(s) 172, 218, 305, 343
BauI CACGAG 1 cut(s) 288
BbsI GAAGAC 1 cut(s) 147
BccI CCATC 1 cut(s) 236
BciT130I CCWGG 2 cut(s) 201, 279
BcoDI GTCTC 2 cut(s) 291, 441
BfaI CTAG 1 cut(s) 119
Bme1390I CCNGG 2 cut(s) 201, 279
BmrFI CCNGG 2 cut(s) 201, 279
BpiI GAAGAC 1 cut(s) 147
BplI GAGNNNNNCTC 2 cut(s) 438, 470
BpuEI CTTGAG 1 cut(s) 442
BsaJI CCNNGG 1 cut(s) 200
BsaXI ACNNNNNCTCC 2 cut(s) 376, 406
BseBI CCWGG 2 cut(s) 201, 279
BseDI CCNNGG 1 cut(s) 200
BseGI GGATG 1 cut(s) 16
BseMII CTCAG 1 cut(s) 24
BseRI GAGGAG 1 cut(s) 77
BshFI GGCC 2 cut(s) 233, 277
BsmAI GTCTC 2 cut(s) 291, 441
BsnI GGCC 2 cut(s) 233, 277
Bsp143I GATC 1 cut(s) 295
BspACI CCGC 1 cut(s) 324
BspANI GGCC 2 cut(s) 233, 277
BspCNI CTCAG 1 cut(s) 25
BssECI CCNNGG 1 cut(s) 200
BssMI GATC 1 cut(s) 295
BssSI CACGAG 1 cut(s) 288
Bst2BI CACGAG 1 cut(s) 288
Bst2UI CCWGG 2 cut(s) 201, 279
Bst6I CTCTTC 2 cut(s) 341, 470
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 4 cut(s) 33, 84, 93, 396
BstF5I GGATG 1 cut(s) 16
BstKTI GATC 1 cut(s) 298
BstMAI GTCTC 2 cut(s) 291, 441
BstMBI GATC 1 cut(s) 295
BstNI CCWGG 2 cut(s) 201, 279
BstSCI CCNGG 2 cut(s) 199, 277
BstV2I GAAGAC 1 cut(s) 147
BsuRI GGCC 2 cut(s) 233, 277
BtsCI GGATG 1 cut(s) 16
BtsIMutI CAGTG 1 cut(s) 310
Cac8I GCNNGC 1 cut(s) 114
CviAII CATG 1 cut(s) 178
CviJI RGCY 9 cut(s) 37, 88, 116, 136, 233, 250, 277, 413, 438
CviKI_1 RGCY 9 cut(s) 37, 88, 116, 136, 233, 250, 277, 413, 438
DdeI CTNAG 4 cut(s) 33, 84, 93, 396
DpnI GATC 1 cut(s) 297
DpnII GATC 1 cut(s) 295
Eam1104I CTCTTC 2 cut(s) 341, 470
EarI CTCTTC 2 cut(s) 341, 470
EcoRII CCWGG 2 cut(s) 199, 277
FaeI CATG 1 cut(s) 181
FaiI YATR 3 cut(s) 57, 150, 179
FalI AAGNNNNNCTT 2 cut(s) 86, 118
FatI CATG 1 cut(s) 177
FauI CCCGC 1 cut(s) 317
FokI GGATG 1 cut(s) 23
FspBI CTAG 1 cut(s) 119
HaeIII GGCC 2 cut(s) 233, 277
Hin1II CATG 1 cut(s) 181
HinfI GANTC 3 cut(s) 41, 170, 362
HphI GGTGA 4 cut(s) 172, 218, 305, 343
Hpy188I TCNGA 2 cut(s) 34, 46
Hpy188III TCNNGA 2 cut(s) 119, 459
HpyAV CCTTC 2 cut(s) 99, 322
HpyCH4V TGCA 1 cut(s) 152
HpyF3I CTNAG 4 cut(s) 33, 84, 93, 396
Hsp92II CATG 1 cut(s) 181
Kzo9I GATC 1 cut(s) 295
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 7 cut(s) 51, 63, 98, 186, 213, 264, 291
MaeI CTAG 1 cut(s) 119
MaeIII GTNAC 2 cut(s) 206, 331
MalI GATC 1 cut(s) 297
MboI GATC 1 cut(s) 295
MboII GAAGA 7 cut(s) 17, 32, 80, 152, 251, 355, 358
MluCI AATT 1 cut(s) 77
MmeI TCCRAC 1 cut(s) 204
MnlI CCTC 9 cut(s) 55, 58, 115, 126, 267, 374, 378, 428, 471
MspR9I CCNGG 2 cut(s) 201, 279
MvaI CCWGG 2 cut(s) 201, 279
NdeII GATC 1 cut(s) 295
NlaIII CATG 1 cut(s) 181
NmuCI GTSAC 2 cut(s) 206, 331
PfeI GAWTC 3 cut(s) 41, 170, 362
Psp6I CCWGG 2 cut(s) 199, 277
PspGI CCWGG 2 cut(s) 199, 277
Sau3AI GATC 1 cut(s) 295
ScrFI CCNGG 2 cut(s) 201, 279
SetI ASST 6 cut(s) 217, 283, 333, 394, 415, 482
SmlI CTYRAG 1 cut(s) 457
SmoI CTYRAG 1 cut(s) 457
Sse9I AATT 1 cut(s) 77
SsiI CCGC 1 cut(s) 324
SspMI CTAG 1 cut(s) 119
StyD4I CCNGG 2 cut(s) 199, 277
TasI AATT 1 cut(s) 77
TfiI GAWTC 3 cut(s) 41, 170, 362
TscAI CASTG 1 cut(s) 310
TseFI GTSAC 2 cut(s) 206, 331
Tsp45I GTSAC 2 cut(s) 206, 331
TspRI CASTG 1 cut(s) 310
XbaI TCTAGA 1 cut(s) 118
XspI CTAG 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.