Prupe.2G115400_v2.0.a1

rRNA-processing protein EBP2 homolog

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
17336689 .. 17337020
332 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G115400.1

Sequence Viewer

Length: 204 bp
ATGGAACCCATGAAGAAATCGGTCTGTGGAAAGGCAAGACAAGGTGGGAAGGTGAAGAAACCAATGAAGAGGGAAATCAAGGATTCCAAGTTTGGATTTGGAGGGAGGAAAGGTTCTAAGAAGCAAAATGTAGCTGAAACAACTAATGATTTGAGAGGCTTCAATAGAGATAGTCTCTCAAGAAATAAGAAAAGGAAGAGGTGA

Protein Analysis

68

Amino Acids

7.64

Weight (kDa)

11.15

Isoelectric Point (pI)

43.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 163
AloI GAACNNNNNNTCC 2 cut(s) 97, 129
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
Alw26I GTCTC 1 cut(s) 179
AsuHPI GGTGA 1 cut(s) 64
BcoDI GTCTC 1 cut(s) 179
BmiI GGNNCC 1 cut(s) 6
BplI GAGNNNNNCTC 2 cut(s) 159, 191
BpuEI CTTGAG 1 cut(s) 163
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
BsmAI GTCTC 1 cut(s) 179
BspLI GGNNCC 1 cut(s) 6
Bst6I CTCTTC 2 cut(s) 62, 191
BstDEI CTNAG 1 cut(s) 117
BstMAI GTCTC 1 cut(s) 179
CviAII CATG 1 cut(s) 10
CviJI RGCY 2 cut(s) 134, 159
CviKI_1 RGCY 2 cut(s) 134, 159
DdeI CTNAG 1 cut(s) 117
Eam1104I CTCTTC 2 cut(s) 62, 191
EarI CTCTTC 2 cut(s) 62, 191
FaeI CATG 1 cut(s) 13
FaiI YATR 1 cut(s) 11
FatI CATG 1 cut(s) 9
Hin1II CATG 1 cut(s) 13
HinfI GANTC 1 cut(s) 83
HphI GGTGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 180
HpyAV CCTTC 1 cut(s) 43
HpyF3I CTNAG 1 cut(s) 117
Hsp92II CATG 1 cut(s) 13
MboII GAAGA 3 cut(s) 25, 67, 79
MnlI CCTC 5 cut(s) 63, 95, 99, 149, 192
NlaIII CATG 1 cut(s) 13
NlaIV GGNNCC 1 cut(s) 6
PfeI GAWTC 1 cut(s) 83
PspN4I GGNNCC 1 cut(s) 6
SetI ASST 5 cut(s) 46, 54, 115, 136, 203
SgeI CNNG 6 cut(s) 22, 48, 53, 91, 100, 192
SmlI CTYRAG 1 cut(s) 178
SmoI CTYRAG 1 cut(s) 178
TaqII GACCGA 1 cut(s) 10
TfiI GAWTC 1 cut(s) 83
TspDTI ATGAA 2 cut(s) 26, 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.