pycom15g37110

Protein of unknown function (DUF1639)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
37027675 .. 37027866
192 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g37110.1

Sequence Viewer

Length: 192 bp
ATGGTGTATATAGGCGGGTCGGATGAGGAGGAGAGAGTGGAGGTGAAGTCCATGGCGATGGGTTCTGAGAGGGCGAAGCCTCTACACAATTTCAACCTAAGGGGAGCTCCGACGCAAGCGGGAGTGGTGGGGAAGGGTTTAGGGTTAATCGGCGATCGTCGGCTCAGAGGATTGAGAGCTCGCCAGCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

6.89

Weight (kDa)

10.81

Isoelectric Point (pI)

39.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 15, 119, 187
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 2 cut(s) 107, 179
AluI AGCT 2 cut(s) 107, 179
Alw21I GWGCWC 2 cut(s) 109, 181
AsuHPI GGTGA 1 cut(s) 55
AxyI CCTNAGG 1 cut(s) 98
BanII GRGCYC 2 cut(s) 109, 181
Bbv12I GWGCWC 2 cut(s) 109, 181
BccI CCATC 1 cut(s) 52
BsaJI CCNNGG 1 cut(s) 51
BsaXI ACNNNNNCTCC 2 cut(s) 32, 62
Bse21I CCTNAGG 1 cut(s) 98
BseDI CCNNGG 1 cut(s) 51
BseGI GGATG 1 cut(s) 28
BseMII CTCAG 2 cut(s) 57, 178
BseRI GAGGAG 2 cut(s) 41, 44
Bsh1285I CGRYCG 1 cut(s) 157
BsiEI CGRYCG 1 cut(s) 157
BsiHKAI GWGCWC 2 cut(s) 109, 181
Bsp1286I GDGCHC 2 cut(s) 109, 181
Bsp143I GATC 1 cut(s) 154
Bsp19I CCATGG 1 cut(s) 51
BspACI CCGC 3 cut(s) 15, 119, 187
BspCNI CTCAG 2 cut(s) 58, 177
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 1 cut(s) 154
BssT1I CCWWGG 1 cut(s) 51
BstC8I GCNNGC 3 cut(s) 117, 181, 185
BstDEI CTNAG 3 cut(s) 66, 98, 164
BstDSI CCRYGG 1 cut(s) 51
BstF5I GGATG 1 cut(s) 28
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstMCI CGRYCG 1 cut(s) 157
BstXI CCANNNNNNTGG 1 cut(s) 58
Bsu36I CCTNAGG 1 cut(s) 98
BtgI CCRYGG 1 cut(s) 51
BtgZI GCGATG 1 cut(s) 71
BtsCI GGATG 1 cut(s) 28
Cac8I GCNNGC 3 cut(s) 117, 181, 185
CseI GACGC 1 cut(s) 121
CviAII CATG 1 cut(s) 52
CviJI RGCY 4 cut(s) 79, 107, 163, 179
CviKI_1 RGCY 4 cut(s) 79, 107, 163, 179
DdeI CTNAG 3 cut(s) 66, 98, 164
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
Ecl136II GAGCTC 2 cut(s) 107, 179
Eco130I CCWWGG 1 cut(s) 51
Eco24I GRGCYC 2 cut(s) 109, 181
Eco53kI GAGCTC 2 cut(s) 107, 179
Eco81I CCTNAGG 1 cut(s) 98
EcoICRI GAGCTC 2 cut(s) 107, 179
EcoT14I CCWWGG 1 cut(s) 51
EcoT38I GRGCYC 2 cut(s) 109, 181
ErhI CCWWGG 1 cut(s) 51
FaeI CATG 1 cut(s) 55
FaiI YATR 3 cut(s) 9, 11, 53
FatI CATG 1 cut(s) 51
FauI CCCGC 2 cut(s) 8, 112
FokI GGATG 1 cut(s) 35
FriOI GRGCYC 2 cut(s) 109, 181
HgaI GACGC 1 cut(s) 121
Hin1II CATG 1 cut(s) 55
HphI GGTGA 1 cut(s) 55
Hpy188I TCNGA 4 cut(s) 22, 67, 111, 167
Hpy99I CGWCG 2 cut(s) 115, 162
HpyAV CCTTC 1 cut(s) 127
HpyF3I CTNAG 3 cut(s) 66, 98, 164
Hsp92II CATG 1 cut(s) 55
Kzo9I GATC 1 cut(s) 154
LmnI GCTCC 2 cut(s) 104, 112
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MhlI GDGCHC 2 cut(s) 109, 181
MluCI AATT 1 cut(s) 88
MmeI TCCRAC 1 cut(s) 134
MnlI CCTC 6 cut(s) 19, 22, 34, 63, 90, 161
MseI TTAA 1 cut(s) 146
MslI CAYNNNNRTG 1 cut(s) 56
MspA1I CMGCKG 1 cut(s) 187
NcoI CCATGG 1 cut(s) 51
NdeII GATC 1 cut(s) 154
NlaIII CATG 1 cut(s) 55
Ple19I CGATCG 1 cut(s) 157
Psp124BI GAGCTC 2 cut(s) 109, 181
PvuI CGATCG 1 cut(s) 157
RseI CAYNNNNRTG 1 cut(s) 56
SacI GAGCTC 2 cut(s) 109, 181
SaqAI TTAA 1 cut(s) 146
Sau3AI GATC 1 cut(s) 154
SduI GDGCHC 2 cut(s) 109, 181
SetI ASST 4 cut(s) 45, 99, 109, 181
SgeI CNNG 4 cut(s) 28, 64, 128, 132
SmiMI CAYNNNNRTG 1 cut(s) 56
Sse9I AATT 1 cut(s) 88
SsiI CCGC 3 cut(s) 15, 119, 187
SstI GAGCTC 2 cut(s) 109, 181
StyI CCWWGG 1 cut(s) 51
TasI AATT 1 cut(s) 88
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.