RchiOBHm_Chr3g0478461

Clathrin is the major protein of the polyhedral coat of coated pits and vesicles

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
24224326 .. 24226858
2533 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 168 bp
ATGGAGTCCAATAAGTACACATGTGTTCAGGAAACAATGTCGCAGAATAGTATTGTGATTATTGATATGAGTGTGCTGAATCAACGCCGACTCTGCACTTATGAATCCAAACTCCCAAATCCTTGCTTTGAAAGCTCAAGTGCAGGGAACTACTCAAGACCCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

55

Amino Acids

6.25

Weight (kDa)

6.06

Isoelectric Point (pI)

72.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 17
AflIII ACRYGT 1 cut(s) 20
AgsI TTSAA 1 cut(s) 131
AluBI AGCT 1 cut(s) 135
AluI AGCT 1 cut(s) 135
BpuEI CTTGAG 2 cut(s) 121, 139
BsgI GTGCAG 2 cut(s) 79, 162
BstMWI GCNNNNNNNGC 2 cut(s) 93, 132
BstNSI RCATGY 1 cut(s) 24
Csp6I GTAC 1 cut(s) 16
CviAII CATG 1 cut(s) 21
CviJI RGCY 1 cut(s) 135
CviKI_1 RGCY 1 cut(s) 135
CviQI GTAC 1 cut(s) 16
FaeI CATG 1 cut(s) 24
FaiI YATR 3 cut(s) 22, 68, 102
FalI AAGNNNNNCTT 1 cut(s) 148
FatI CATG 1 cut(s) 20
FspEI CC 9 cut(s) 14, 22, 101, 121, 128, 129, 129, 130, 135
Hin1II CATG 1 cut(s) 24
HinfI GANTC 4 cut(s) 5, 79, 90, 104
Hpy166II GTNNAC 1 cut(s) 18
Hpy188III TCNNGA 2 cut(s) 29, 156
Hpy8I GTNNAC 1 cut(s) 18
HpyCH4V TGCA 2 cut(s) 96, 143
HpyF10VI GCNNNNNNNGC 2 cut(s) 93, 132
Hsp92II CATG 1 cut(s) 24
LpnPI CCDG 2 cut(s) 14, 129
MlyI GAGTC 2 cut(s) 14, 84
MseI TTAA 1 cut(s) 166
MwoI GCNNNNNNNGC 2 cut(s) 93, 132
NlaIII CATG 1 cut(s) 24
NspI RCATGY 1 cut(s) 24
PciI ACATGT 1 cut(s) 20
PfeI GAWTC 2 cut(s) 79, 104
PleI GAGTC 2 cut(s) 13, 84
PpsI GAGTC 2 cut(s) 13, 84
PscI ACATGT 1 cut(s) 20
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
SaqAI TTAA 1 cut(s) 166
SchI GAGTC 2 cut(s) 14, 84
SetI ASST 1 cut(s) 137
SgeI CNNG 5 cut(s) 33, 41, 135, 150, 156
SmlI CTYRAG 2 cut(s) 136, 154
SmoI CTYRAG 2 cut(s) 136, 154
TatI WGTACW 1 cut(s) 15
TfiI GAWTC 2 cut(s) 79, 104
Tru1I TTAA 1 cut(s) 166
Tru9I TTAA 1 cut(s) 166
TspDTI ATGAA 1 cut(s) 117
XceI RCATGY 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.