Rmu_sc0000335.1_g000004

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. The coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000335.1
Physical Location & Seq
Forward (+)
20087 .. 20383
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000335.1_g000004.1.cds

Sequence Viewer

Length: 210 bp
atgcataggtctgattctgctaaaagttggctgaaggaaatgcaaaagattgatgaggaccacaccttaactcaacttgcaacggcatggcaaaatctggctgtgggtggttctatgatacaggaggcatatctcatcttccaagatttctctaagaagtctcaggttacaagcttgattttgaatggaaagggaaacactgcttcttga

Protein Analysis

69

Amino Acids

7.7

Weight (kDa)

6.71

Isoelectric Point (pI)

27.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 53
AgsI TTSAA 1 cut(s) 184
AluBI AGCT 1 cut(s) 174
AluI AGCT 1 cut(s) 174
Alw26I GTCTC 1 cut(s) 165
AspS9I GGNCC 1 cut(s) 58
AvaII GGWCC 1 cut(s) 58
BceAI ACGGC 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 58
BmgT120I GGNCC 1 cut(s) 58
BseMII CTCAG 1 cut(s) 176
BsmAI GTCTC 1 cut(s) 165
BspCNI CTCAG 1 cut(s) 175
BstDEI CTNAG 2 cut(s) 153, 162
BstMAI GTCTC 1 cut(s) 165
BtsI GCAGTG 1 cut(s) 198
BtsIMutI CAGTG 1 cut(s) 198
Cfr13I GGNCC 1 cut(s) 58
CviAII CATG 1 cut(s) 87
CviJI RGCY 3 cut(s) 31, 101, 174
CviKI_1 RGCY 3 cut(s) 31, 101, 174
DdeI CTNAG 2 cut(s) 153, 162
Eco47I GGWCC 1 cut(s) 58
Eco57I CTGAAG 1 cut(s) 53
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 90
FaiI YATR 4 cut(s) 6, 88, 116, 130
FatI CATG 1 cut(s) 86
Hin1II CATG 1 cut(s) 90
HindIII AAGCTT 1 cut(s) 172
HinfI GANTC 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 13
Hpy188III TCNNGA 1 cut(s) 207
HpyAV CCTTC 1 cut(s) 28
HpyCH4V TGCA 3 cut(s) 4, 43, 80
HpyF3I CTNAG 2 cut(s) 153, 162
Hsp92II CATG 1 cut(s) 90
LpnPI CCDG 3 cut(s) 83, 107, 149
MaeIII GTNAC 1 cut(s) 166
MboII GAAGA 1 cut(s) 130
MnlI CCTC 2 cut(s) 49, 118
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 68
NlaIII CATG 1 cut(s) 90
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 14
PspPI GGNCC 1 cut(s) 58
SaqAI TTAA 1 cut(s) 68
Sau96I GGNCC 1 cut(s) 58
SetI ASST 4 cut(s) 11, 68, 168, 176
SgeI CNNG 8 cut(s) 89, 99, 110, 134, 155, 176, 183, 187
SinI GGWCC 1 cut(s) 58
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
TscAI CASTG 1 cut(s) 205
TspRI CASTG 1 cut(s) 205
VpaK11BI GGWCC 1 cut(s) 58
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.