Rorug04G0220000

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. The coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
37952593 .. 37953258
666 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0220000.1

Sequence Viewer

Length: 438 bp
ATGTCTAGTAGTAAAGCTGAAGAACCTGTAAATGAGCAAGCTGTTGCAAATAAGTTTGCTGCCATGAGGTCTGAACTCAACCAAATTTACTCTAAAATCACTGAGCTAGAGATGGACGTGAGCGAGCACTCATTGGTGATCAATGCCATCCAGCCACTCGACCCATCCAGGCGGTGCTTCAGAATGATTGGAGGTGTACTGGTGGAGAGAACCATCAAGGAGGTCCTGCCTGCTGTGCAGCGTAACAAAGAAGGGATTGAGGAGGTTATTACTCGGTTGAATGAGGCTTTGGAAAGGAAGAAAAAAGAAATTTCTGACTTTGAGGCTAAGTACAAGATCCAGATAAGAAAGAACGACAATGAGGAGAAGGATGGTGGTGCTCGCAAAGAAGGAACTGCTCAAGGAGTCCTGGTCGGCCCTGCTGGTGGAAGCGAATGA

Protein Analysis

145

Amino Acids

16.16

Weight (kDa)

5.67

Isoelectric Point (pI)

51.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prefoldin_2 PF01920 13 - 117 2.2e-26 Prefoldin subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 172
AclWI GGATC 1 cut(s) 331
AcsI RAATTY 2 cut(s) 84, 309
AcuI CTGAAG 2 cut(s) 39, 163
AfaI GTAC 2 cut(s) 198, 332
AfiI CCNNNNNNNGG 1 cut(s) 425
AgsI TTSAA 1 cut(s) 280
AjiI CACGTC 1 cut(s) 118
AjnI CCWGG 2 cut(s) 167, 408
AjuI GAANNNNNNNTTGG 2 cut(s) 272, 304
AluBI AGCT 3 cut(s) 17, 41, 106
AluI AGCT 3 cut(s) 17, 41, 106
Alw21I GWGCWC 2 cut(s) 129, 382
AlwI GGATC 1 cut(s) 331
AoxI GGCC 1 cut(s) 415
ApeKI GCWGC 2 cut(s) 59, 238
ApoI RAATTY 2 cut(s) 84, 309
AspS9I GGNCC 2 cut(s) 223, 416
AsuHPI GGTGA 1 cut(s) 148
AvaII GGWCC 1 cut(s) 223
Bbv12I GWGCWC 2 cut(s) 129, 382
BbvI GCAGC 2 cut(s) 46, 250
BccI CCATC 5 cut(s) 106, 155, 172, 221, 365
BciT130I CCWGG 2 cut(s) 169, 410
BclI TGATCA 1 cut(s) 138
BfaI CTAG 2 cut(s) 6, 107
BisI GCNGC 2 cut(s) 60, 239
BlsI GCNGC 2 cut(s) 61, 240
Bme1390I CCNGG 2 cut(s) 169, 410
Bme18I GGWCC 1 cut(s) 223
BmgBI CACGTC 1 cut(s) 118
BmgT120I GGNCC 2 cut(s) 223, 416
BmrFI CCNGG 2 cut(s) 169, 410
BpuEI CTTGAG 1 cut(s) 384
BsaXI ACNNNNNCTCC 2 cut(s) 396, 426
Bsc4I CCNNNNNNNGG 1 cut(s) 425
Bse1I ACTGG 1 cut(s) 204
BseBI CCWGG 2 cut(s) 169, 410
BseGI GGATG 3 cut(s) 147, 164, 376
BseLI CCNNNNNNNGG 1 cut(s) 425
BseMII CTCAG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 204
BseRI GAGGAG 2 cut(s) 275, 377
BseXI GCAGC 2 cut(s) 46, 250
BsgI GTGCAG 1 cut(s) 257
BshFI GGCC 1 cut(s) 417
BsiHKAI GWGCWC 2 cut(s) 129, 382
BslI CCNNNNNNNGG 1 cut(s) 425
BsnI GGCC 1 cut(s) 417
Bsp1286I GDGCHC 2 cut(s) 129, 382
Bsp143I GATC 2 cut(s) 138, 336
BspACI CCGC 1 cut(s) 172
BspANI GGCC 1 cut(s) 417
BspCNI CTCAG 1 cut(s) 94
BspPI GGATC 1 cut(s) 331
BsrI ACTGG 1 cut(s) 204
BssMI GATC 2 cut(s) 138, 336
Bst2UI CCWGG 2 cut(s) 169, 410
BstC8I GCNNGC 4 cut(s) 39, 125, 231, 382
BstDEI CTNAG 2 cut(s) 102, 327
BstF5I GGATG 3 cut(s) 147, 164, 376
BstKTI GATC 2 cut(s) 141, 339
BstMBI GATC 2 cut(s) 138, 336
BstMWI GCNNNNNNNGC 1 cut(s) 235
BstNI CCWGG 2 cut(s) 169, 410
BstSCI CCNGG 2 cut(s) 167, 408
BstV1I GCAGC 2 cut(s) 46, 250
BstX2I RGATCY 1 cut(s) 336
BstYI RGATCY 1 cut(s) 336
BsuRI GGCC 1 cut(s) 417
BtrI CACGTC 1 cut(s) 118
BtsCI GGATG 3 cut(s) 147, 164, 376
BtsIMutI CAGTG 1 cut(s) 99
Cac8I GCNNGC 4 cut(s) 39, 125, 231, 382
Cfr13I GGNCC 2 cut(s) 223, 416
Csp6I GTAC 2 cut(s) 197, 331
CviAII CATG 1 cut(s) 64
CviJI RGCY 7 cut(s) 17, 41, 106, 154, 287, 326, 417
CviKI_1 RGCY 7 cut(s) 17, 41, 106, 154, 287, 326, 417
CviQI GTAC 2 cut(s) 197, 331
DdeI CTNAG 2 cut(s) 102, 327
DpnI GATC 2 cut(s) 140, 338
DpnII GATC 2 cut(s) 138, 336
Eco47I GGWCC 1 cut(s) 223
Eco57I CTGAAG 2 cut(s) 39, 163
EcoO109I RGGNCCY 1 cut(s) 223
EcoRII CCWGG 2 cut(s) 167, 408
FaeI CATG 1 cut(s) 67
FaiI YATR 1 cut(s) 65
FatI CATG 1 cut(s) 63
FbaI TGATCA 1 cut(s) 138
Fnu4HI GCNGC 2 cut(s) 60, 239
FokI GGATG 3 cut(s) 134, 151, 383
Fsp4HI GCNGC 2 cut(s) 60, 239
FspBI CTAG 2 cut(s) 6, 107
GluI GCNGC 2 cut(s) 60, 239
HaeIII GGCC 1 cut(s) 417
Hin1II CATG 1 cut(s) 67
HinfI GANTC 1 cut(s) 405
HphI GGTGA 1 cut(s) 148
Hpy166II GTNNAC 1 cut(s) 197
Hpy188I TCNGA 3 cut(s) 73, 182, 316
Hpy188III TCNNGA 1 cut(s) 340
Hpy8I GTNNAC 1 cut(s) 197
HpyAV CCTTC 3 cut(s) 245, 361, 383
HpyCH4IV ACGT 1 cut(s) 117
HpyCH4V TGCA 2 cut(s) 47, 238
HpyF10VI GCNNNNNNNGC 1 cut(s) 235
HpyF3I CTNAG 2 cut(s) 102, 327
HpySE526I ACGT 1 cut(s) 117
Hsp92II CATG 1 cut(s) 67
Ksp22I TGATCA 1 cut(s) 138
Kzo9I GATC 2 cut(s) 138, 336
Lsp1109I GCAGC 2 cut(s) 46, 250
MaeI CTAG 2 cut(s) 6, 107
MaeII ACGT 1 cut(s) 117
MaeIII GTNAC 1 cut(s) 242
MalI GATC 2 cut(s) 140, 338
MboI GATC 2 cut(s) 138, 336
MboII GAAGA 2 cut(s) 32, 310
MflI RGATCY 1 cut(s) 336
MhlI GDGCHC 2 cut(s) 129, 382
MluCI AATT 2 cut(s) 84, 309
MlyI GAGTC 1 cut(s) 414
MnlI CCTC 8 cut(s) 60, 185, 214, 253, 256, 277, 316, 355
MspR9I CCNGG 2 cut(s) 169, 410
MvaI CCWGG 2 cut(s) 169, 410
MwoI GCNNNNNNNGC 1 cut(s) 235
NdeII GATC 2 cut(s) 138, 336
NlaIII CATG 1 cut(s) 67
PkrI GCNGC 2 cut(s) 61, 240
PleI GAGTC 1 cut(s) 413
PpsI GAGTC 1 cut(s) 413
PpuMI RGGWCCY 1 cut(s) 223
Psp5II RGGWCCY 1 cut(s) 223
Psp6I CCWGG 2 cut(s) 167, 408
PspGI CCWGG 2 cut(s) 167, 408
PspPI GGNCC 2 cut(s) 223, 416
PspPPI RGGWCCY 1 cut(s) 223
PsuI RGATCY 1 cut(s) 336
RsaI GTAC 2 cut(s) 198, 332
RsaNI GTAC 2 cut(s) 197, 331
SatI GCNGC 2 cut(s) 60, 239
Sau3AI GATC 2 cut(s) 138, 336
Sau96I GGNCC 2 cut(s) 223, 416
SchI GAGTC 1 cut(s) 414
ScrFI CCNGG 2 cut(s) 169, 410
SduI GDGCHC 2 cut(s) 129, 382
SetI ASST 9 cut(s) 19, 28, 43, 71, 108, 120, 196, 225, 267
SinI GGWCC 1 cut(s) 223
SmlI CTYRAG 1 cut(s) 399
SmoI CTYRAG 1 cut(s) 399
Sse9I AATT 2 cut(s) 84, 309
SsiI CCGC 1 cut(s) 172
SspMI CTAG 2 cut(s) 6, 107
StyD4I CCNGG 2 cut(s) 167, 408
TaiI ACGT 1 cut(s) 120
TaqI TCGA 1 cut(s) 159
TasI AATT 2 cut(s) 84, 309
TatI WGTACW 2 cut(s) 196, 330
TscAI CASTG 1 cut(s) 106
TseI GCWGC 2 cut(s) 59, 238
TspRI CASTG 1 cut(s) 106
VpaK11BI GGWCC 1 cut(s) 223
XapI RAATTY 2 cut(s) 84, 309
XspI CTAG 2 cut(s) 6, 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.