RchiOBHm_Chr6g0289631

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. The coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
52668106 .. 52670462
2357 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25983

Sequence Viewer

Length: 294 bp
ATGCCGCATAATAGTATTGTGATTATTGATATGAGTGTGCCGAATCAACGCCGACTCTGCACTTATGAATCCAAACTCCCAAATCCTTGCCTTGAAAGGGATCCGCTGAATGTCCAAATATTCCTCAAAATGCATATGTCTGATTATGCTAAAAGATGGCTGAAGGAAATGCAAAATATTGATGAGGACCACACCTTAACTCAACTTGAAACAGCATGGCAAAATCTGGCTGTGGGTGGTTCTAAGTTACAGGAGGCATATCTCATCTTCCAAGATTTCTCTGAGAAGTCTTAG

Protein Analysis

97

Amino Acids

11.38

Weight (kDa)

5.5

Isoelectric Point (pI)

71.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Coatomer_E PF04733 31 - 96 6.4e-27 Coatomer epsilon subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 5, 104
AclWI GGATC 2 cut(s) 95, 108
AcuI CTGAAG 1 cut(s) 182
AfiI CCNNNNNNNGG 1 cut(s) 97
AgsI TTSAA 2 cut(s) 95, 209
AlwI GGATC 2 cut(s) 95, 108
AspS9I GGNCC 1 cut(s) 187
AvaII GGWCC 1 cut(s) 187
BamHI GGATCC 1 cut(s) 100
BccI CCATC 1 cut(s) 150
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
Bme18I GGWCC 1 cut(s) 187
BmgT120I GGNCC 1 cut(s) 187
BmiI GGNNCC 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 97
BseLI CCNNNNNNNGG 1 cut(s) 97
BseMII CTCAG 1 cut(s) 273
BsgI GTGCAG 1 cut(s) 43
BslI CCNNNNNNNGG 1 cut(s) 97
Bsp143I GATC 1 cut(s) 100
BspACI CCGC 2 cut(s) 5, 104
BspCNI CTCAG 1 cut(s) 274
BspLI GGNNCC 1 cut(s) 102
BspPI GGATC 2 cut(s) 95, 108
BssMI GATC 1 cut(s) 100
BstDEI CTNAG 3 cut(s) 243, 282, 291
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BstMWI GCNNNNNNNGC 1 cut(s) 57
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
Cfr13I GGNCC 1 cut(s) 187
CviAII CATG 1 cut(s) 216
CviJI RGCY 2 cut(s) 160, 230
CviKI_1 RGCY 2 cut(s) 160, 230
DdeI CTNAG 3 cut(s) 243, 282, 291
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
Eco47I GGWCC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 182
EcoT22I ATGCAT 1 cut(s) 135
FaeI CATG 1 cut(s) 219
FaiI YATR 8 cut(s) 9, 32, 66, 135, 137, 147, 217, 259
FatI CATG 1 cut(s) 215
FauNDI CATATG 1 cut(s) 135
Fnu4HI GCNGC 1 cut(s) 5
Fsp4HI GCNGC 1 cut(s) 5
GluI GCNGC 1 cut(s) 5
Hin1II CATG 1 cut(s) 219
HinfI GANTC 3 cut(s) 43, 54, 68
Hpy188I TCNGA 2 cut(s) 142, 283
HpyAV CCTTC 1 cut(s) 157
HpyCH4V TGCA 3 cut(s) 60, 133, 172
HpyF10VI GCNNNNNNNGC 1 cut(s) 57
HpyF3I CTNAG 3 cut(s) 243, 282, 291
Hsp92II CATG 1 cut(s) 219
Kzo9I GATC 1 cut(s) 100
LpnPI CCDG 2 cut(s) 212, 236
MaeIII GTNAC 1 cut(s) 246
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MboII GAAGA 1 cut(s) 259
MflI RGATCY 1 cut(s) 100
MlyI GAGTC 1 cut(s) 48
MnlI CCTC 3 cut(s) 134, 178, 247
Mph1103I ATGCAT 1 cut(s) 135
MseI TTAA 1 cut(s) 197
MspA1I CMGCKG 1 cut(s) 106
MwoI GCNNNNNNNGC 1 cut(s) 57
NdeI CATATG 1 cut(s) 135
NdeII GATC 1 cut(s) 100
NlaIII CATG 1 cut(s) 219
NlaIV GGNNCC 1 cut(s) 102
NsiI ATGCAT 1 cut(s) 135
PfeI GAWTC 2 cut(s) 43, 68
PkrI GCNGC 1 cut(s) 6
PleI GAGTC 1 cut(s) 48
PpsI GAGTC 1 cut(s) 48
PspN4I GGNNCC 1 cut(s) 102
PspPI GGNCC 1 cut(s) 187
PsuI RGATCY 1 cut(s) 100
SaqAI TTAA 1 cut(s) 197
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 1 cut(s) 100
Sau96I GGNCC 1 cut(s) 187
SchI GAGTC 1 cut(s) 48
SetI ASST 1 cut(s) 197
SgeI CNNG 7 cut(s) 99, 104, 218, 228, 239, 263, 284
SinI GGWCC 1 cut(s) 187
SsiI CCGC 2 cut(s) 5, 104
SspI AATATT 2 cut(s) 120, 178
TauI GCSGC 1 cut(s) 7
TfiI GAWTC 2 cut(s) 43, 68
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 81
VpaK11BI GGWCC 1 cut(s) 187
Zsp2I ATGCAT 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.