Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8182516.1

Orthogroup ID

OG0001768

Physical Location & Seq

Genomic Coordinates Reverse (-)

60 .. 586

Gene Structure 527 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8182516.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 357 bp

atggccgccgctgccaatgcccccatgaccatgaaagagcagctcacgctgcctagtattgggattaatccccaattcattacgtttacgcatgtgactatggaatcggataagtacatttgcgttagggagacctcgccgcagaatagcatcgtgatcgttgacatgaacatgccaatgcagccgttgcgacggccgattactgctgattccgctttgatgaatcctaattcgaggattctggctcttaaaggtatgattttaatgcaatgccggcctcggtttcgtcactgtggatgttttgatgggaacctgtttatcggaaatgattggttattggcatatagaaaagcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04142 ko04144 ko04721 ko04961 ko05016 ko05100 map04142 map04144 map04721 map04961 map05016 map05100

Pfam Domains

Protein Families

Clathrin Clathrin-link Clathrin_H_link Clathrin_propel

Protein Analysis

118

Amino Acids

13.3

Weight (kDa)

9.13

Isoelectric Point (pI)

36.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001768)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr0c29g0501101 RchiOBHm_Chr1g0337861 RchiOBHm_Chr3g0465841 RchiOBHm_Chr3g0478461 RchiOBHm_Chr4g0403301 RchiOBHm_Chr4g0426291 RchiOBHm_Chr5g0002501 RchiOBHm_Chr5g0047701 RchiOBHm_Chr5g0057331 RchiOBHm_Chr6g0289621 RchiOBHm_Chr6g0289631
rosa_laevigata	RLG00000014682 RLG00000018045
rosa_multiflora	Rmu_co8182516.1_g000001 Rmu_sc0000335.1_g000004 Rmu_sc0041332.1_g000001
rosa_roxburghii	Rroxscaffold_2G00155570 Rroxscaffold_3G00238240
rosa_rugosa	Rorug04G0219900 Rorug04G0220000 Rorug04G0420300 Rorug04G0420400 Rorug04G0420500 Rorug04G0420600 Rorug05G0111700 Rorug05G0325900 Rorug05G0326000 Rorug06G0152100 Rorug06G0152200 Rorug06G0152300 Rorug07G0231200
rosa_samantha	Rh2AG305300 Rh3AG218400 Rh3BG144900 Rh3BG365600 Rh3CG146200 Rh3DG146000 Rh5AG097100 Rh5DG428000 Rh6AG164100 Rh6AG387400 Rh6BG079000 Rh6BG285500 Rh6BG475400 Rh6CG330000 Rh7AG293100 Rh7CG313100
rosa_wichuraiana	Rw6G033750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	4 cut(s)	6, 9, 140, 213
AcoI	YGGCCR	2 cut(s)	3, 194
AfaI	GTAC	1 cut(s)	116
AfiI	CCNNNNNNNGG	1 cut(s)	59
AluBI	AGCT	1 cut(s)	43
AluI	AGCT	1 cut(s)	43
Alw26I	GTCTC	1 cut(s)	125
AoxI	GGCC	3 cut(s)	3, 194, 275
ApeKI	GCWGC	4 cut(s)	11, 40, 49, 181
AseI	ATTAAT	1 cut(s)	66
BbvI	GCAGC	3 cut(s)	36, 52, 193
BccI	CCATC	1 cut(s)	299
BceAI	ACGGC	2 cut(s)	169, 209
BcgI	CGANNNNNNTGC	2 cut(s)	139, 173
BcoDI	GTCTC	1 cut(s)	125
BfaI	CTAG	1 cut(s)	54
BisI	GCNGC	7 cut(s)	6, 9, 12, 41, 50, 140, 182
BlsI	GCNGC	7 cut(s)	7, 10, 13, 42, 51, 141, 183
BmiI	GGNNCC	1 cut(s)	311
BmsI	GCATC	1 cut(s)	159
BsaI	GGTCTC	1 cut(s)	125
BsaJI	CCNNGG	1 cut(s)	278
Bsc4I	CCNNNNNNNGG	1 cut(s)	59
Bse118I	RCCGGY	1 cut(s)	273
Bse3DI	GCAATG	1 cut(s)	275
BseDI	CCNNGG	1 cut(s)	278
BseGI	GGATG	1 cut(s)	302
BseLI	CCNNNNNNNGG	1 cut(s)	59
BseMI	GCAATG	1 cut(s)	275
BseX3I	CGGCCG	1 cut(s)	194
BseXI	GCAGC	3 cut(s)	36, 52, 193
Bsh1285I	CGRYCG	1 cut(s)	197
BshFI	GGCC	3 cut(s)	5, 196, 277
BsiEI	CGRYCG	1 cut(s)	197
BsiSI	CCGG	1 cut(s)	274
BslI	CCNNNNNNNGG	1 cut(s)	59
BsmAI	GTCTC	1 cut(s)	125
BsnI	GGCC	3 cut(s)	5, 196, 277
Bso31I	GGTCTC	1 cut(s)	125
Bsp143I	GATC	1 cut(s)	156
BspACI	CCGC	4 cut(s)	6, 9, 140, 213
BspANI	GGCC	3 cut(s)	5, 196, 277
BspLI	GGNNCC	1 cut(s)	311
BspTNI	GGTCTC	1 cut(s)	125
BsrDI	GCAATG	1 cut(s)	275
BsrFI	RCCGGY	1 cut(s)	273
BssAI	RCCGGY	1 cut(s)	273
BssECI	CCNNGG	1 cut(s)	278
BssMI	GATC	1 cut(s)	156
Bst4CI	ACNGT	1 cut(s)	293
BstAPI	GCANNNNNTGC	1 cut(s)	187
BstC8I	GCNNGC	1 cut(s)	275
BstF5I	GGATG	1 cut(s)	302
BstKTI	GATC	1 cut(s)	159
BstMAI	GTCTC	1 cut(s)	125
BstMBI	GATC	1 cut(s)	156
BstMCI	CGRYCG	1 cut(s)	197
BstMWI	GCNNNNNNNGC	8 cut(s)	11, 17, 46, 49, 181, 187, 212, 274
BstNSI	RCATGY	2 cut(s)	95, 175
BstV1I	GCAGC	3 cut(s)	36, 52, 193
BstZI	CGGCCG	1 cut(s)	194
BsuRI	GGCC	3 cut(s)	5, 196, 277
BtsCI	GGATG	1 cut(s)	302
BtsIMutI	CAGTG	1 cut(s)	289
Cac8I	GCNNGC	1 cut(s)	275
Cfr10I	RCCGGY	1 cut(s)	273
Csp6I	GTAC	1 cut(s)	115
CviAII	CATG	6 cut(s)	25, 31, 92, 166, 172, 354
CviJI	RGCY	6 cut(s)	5, 43, 184, 196, 245, 277
CviKI_1	RGCY	6 cut(s)	5, 43, 184, 196, 245, 277
CviQI	GTAC	1 cut(s)	115
DpnI	GATC	1 cut(s)	158
DpnII	GATC	1 cut(s)	156
EaeI	YGGCCR	2 cut(s)	3, 194
EagI	CGGCCG	1 cut(s)	194
EclXI	CGGCCG	1 cut(s)	194
Eco31I	GGTCTC	1 cut(s)	125
Eco52I	CGGCCG	1 cut(s)	194
FaeI	CATG	6 cut(s)	28, 34, 95, 169, 175, 357
FatI	CATG	6 cut(s)	24, 30, 91, 165, 171, 353
Fnu4HI	GCNGC	7 cut(s)	6, 9, 12, 41, 50, 140, 182
FokI	GGATG	1 cut(s)	309
Fsp4HI	GCNGC	7 cut(s)	6, 9, 12, 41, 50, 140, 182
FspBI	CTAG	1 cut(s)	54
GluI	GCNGC	7 cut(s)	6, 9, 12, 41, 50, 140, 182
HaeIII	GGCC	3 cut(s)	5, 196, 277
HapII	CCGG	1 cut(s)	274
Hin1II	CATG	6 cut(s)	28, 34, 95, 169, 175, 357
HincII	GTYRAC	1 cut(s)	163
HindII	GTYRAC	1 cut(s)	163
HinfI	GANTC	4 cut(s)	104, 209, 223, 238
HpaII	CCGG	1 cut(s)	274
Hpy166II	GTNNAC	2 cut(s)	87, 163
Hpy188I	TCNGA	2 cut(s)	109, 323
Hpy188III	TCNNGA	1 cut(s)	154
Hpy8I	GTNNAC	2 cut(s)	87, 163
Hpy99I	CGWCG	1 cut(s)	195
HpyCH4III	ACNGT	1 cut(s)	293
HpyCH4IV	ACGT	1 cut(s)	83
HpyCH4V	TGCA	2 cut(s)	181, 268
HpyF10VI	GCNNNNNNNGC	8 cut(s)	11, 17, 46, 49, 181, 187, 212, 274
HpySE526I	ACGT	1 cut(s)	83
Hsp92II	CATG	6 cut(s)	28, 34, 95, 169, 175, 357
KroI	GCCGGC	1 cut(s)	273
KroNI	GCCGGC	1 cut(s)	275
Kzo9I	GATC	1 cut(s)	156
LpnPI	CCDG	3 cut(s)	227, 287, 326
Lsp1109I	GCAGC	3 cut(s)	36, 52, 193
LweI	GCATC	1 cut(s)	159
MaeI	CTAG	1 cut(s)	54
MaeII	ACGT	1 cut(s)	83
MaeIII	GTNAC	2 cut(s)	94, 287
MalI	GATC	1 cut(s)	158
MboI	GATC	1 cut(s)	156
MluCI	AATT	2 cut(s)	74, 229
MnlI	CCTC	3 cut(s)	145, 228, 288
MroNI	GCCGGC	1 cut(s)	273
MseI	TTAA	3 cut(s)	66, 249, 263
MslI	CAYNNNNRTG	3 cut(s)	29, 170, 176
MspA1I	CMGCKG	1 cut(s)	11
MspI	CCGG	1 cut(s)	274
MwoI	GCNNNNNNNGC	8 cut(s)	11, 17, 46, 49, 181, 187, 212, 274
NaeI	GCCGGC	1 cut(s)	275
NdeII	GATC	1 cut(s)	156
NgoMIV	GCCGGC	1 cut(s)	273
NlaIII	CATG	6 cut(s)	28, 34, 95, 169, 175, 357
NlaIV	GGNNCC	1 cut(s)	311
NmuCI	GTSAC	2 cut(s)	94, 287
NspI	RCATGY	2 cut(s)	95, 175
PdiI	GCCGGC	1 cut(s)	275
PfeI	GAWTC	4 cut(s)	104, 209, 223, 238
PkrI	GCNGC	7 cut(s)	7, 10, 13, 42, 51, 141, 183
PshBI	ATTAAT	1 cut(s)	66
PspN4I	GGNNCC	1 cut(s)	311
RsaI	GTAC	1 cut(s)	116
RsaNI	GTAC	1 cut(s)	115
RseI	CAYNNNNRTG	3 cut(s)	29, 170, 176
SaqAI	TTAA	3 cut(s)	66, 249, 263
SatI	GCNGC	7 cut(s)	6, 9, 12, 41, 50, 140, 182
Sau3AI	GATC	1 cut(s)	156
SetI	ASST	5 cut(s)	45, 86, 137, 256, 315
SfaNI	GCATC	1 cut(s)	159
SmiMI	CAYNNNNRTG	3 cut(s)	29, 170, 176
Sse9I	AATT	2 cut(s)	74, 229
SsiI	CCGC	4 cut(s)	6, 9, 140, 213
SspMI	CTAG	1 cut(s)	54
TaaI	ACNGT	1 cut(s)	293
TaiI	ACGT	1 cut(s)	86
TaqI	TCGA	1 cut(s)	233
TasI	AATT	2 cut(s)	74, 229
TatI	WGTACW	1 cut(s)	114
TauI	GCSGC	3 cut(s)	8, 11, 142
TfiI	GAWTC	4 cut(s)	104, 209, 223, 238
Tru1I	TTAA	3 cut(s)	66, 249, 263
Tru9I	TTAA	3 cut(s)	66, 249, 263
TscAI	CASTG	1 cut(s)	296
TseFI	GTSAC	2 cut(s)	94, 287
TseI	GCWGC	4 cut(s)	11, 40, 49, 181
Tsp45I	GTSAC	2 cut(s)	94, 287
TspDTI	ATGAA	4 cut(s)	47, 67, 182, 236
TspRI	CASTG	1 cut(s)	296
VspI	ATTAAT	1 cut(s)	66
XceI	RCATGY	2 cut(s)	95, 175
XspI	CTAG	1 cut(s)	54

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.