Rh2AG305300

Clathrin is the major protein of the polyhedral coat of coated pits and vesicles

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
38412342 .. 38413308
967 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG305300.1

Sequence Viewer

Length: 168 bp
ATGGAGTCCAATAAGTACACATGTGTTCGGGAAACAACGCTGCAGAATAGTATTGTGATTATTGATATGAGTGTGCCAAATCAATGCCGACTCTGCACCTATGAATCCAAACTCCTAAATCCTTGCTTTGAAAGGCTAAGAGAACACAGAAACAAGGAGGAATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

55

Amino Acids

6.65

Weight (kDa)

6.54

Isoelectric Point (pI)

44.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 17
AflIII ACRYGT 1 cut(s) 20
AgsI TTSAA 1 cut(s) 131
ApeKI GCWGC 1 cut(s) 40
BbvI GCAGC 1 cut(s) 27
BfmI CTRYAG 1 cut(s) 41
BisI GCNGC 1 cut(s) 41
BlsI GCNGC 1 cut(s) 42
BsaXI ACNNNNNCTCC 1 cut(s) 149
BseXI GCAGC 1 cut(s) 27
BsgI GTGCAG 1 cut(s) 79
BspMAI CTGCAG 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 137
BstMWI GCNNNNNNNGC 1 cut(s) 93
BstNSI RCATGY 1 cut(s) 24
BstSFI CTRYAG 1 cut(s) 41
BstV1I GCAGC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 16
CviAII CATG 1 cut(s) 21
CviJI RGCY 1 cut(s) 136
CviKI_1 RGCY 1 cut(s) 136
CviQI GTAC 1 cut(s) 16
DdeI CTNAG 1 cut(s) 137
FaeI CATG 1 cut(s) 24
FaiI YATR 3 cut(s) 22, 68, 102
FatI CATG 1 cut(s) 20
Fnu4HI GCNGC 1 cut(s) 41
Fsp4HI GCNGC 1 cut(s) 41
GluI GCNGC 1 cut(s) 41
Hin1II CATG 1 cut(s) 24
HinfI GANTC 3 cut(s) 5, 90, 104
Hpy166II GTNNAC 1 cut(s) 18
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 1 cut(s) 18
HpyCH4V TGCA 2 cut(s) 43, 96
HpyF10VI GCNNNNNNNGC 1 cut(s) 93
HpyF3I CTNAG 1 cut(s) 137
Hsp92II CATG 1 cut(s) 24
Lsp1109I GCAGC 1 cut(s) 27
MlyI GAGTC 2 cut(s) 14, 84
MnlI CCTC 1 cut(s) 151
MwoI GCNNNNNNNGC 1 cut(s) 93
NlaIII CATG 1 cut(s) 24
NspI RCATGY 1 cut(s) 24
PciI ACATGT 1 cut(s) 20
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 1 cut(s) 42
PleI GAGTC 2 cut(s) 13, 84
PpsI GAGTC 2 cut(s) 13, 84
PscI ACATGT 1 cut(s) 20
PstI CTGCAG 1 cut(s) 45
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
SatI GCNGC 1 cut(s) 41
SchI GAGTC 2 cut(s) 14, 84
SetI ASST 1 cut(s) 101
SfcI CTRYAG 1 cut(s) 41
SgeI CNNG 3 cut(s) 33, 41, 135
TatI WGTACW 1 cut(s) 15
TfiI GAWTC 1 cut(s) 104
TseI GCWGC 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 117
XceI RCATGY 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.