RchiOBHm_Chr1g0337861

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. The coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
29844893 .. 29847910
3018 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56574

Sequence Viewer

Length: 189 bp
ATGGAAAGGGAAACACTGCTTCTTGAACCATGGAACAAGGATGCAGAGGATCCAGAAACTCTAGCCAACCTGGTCGTATGCTGTCTTCACCTTGGAAAACCACCTTCTCGTTTGGTCAGCCAATCAAGACTTGCACATCCAGACCACGTCCTCATCAAAGGTGCCTCAGCTGTAGAAAGAGAGCTTTGA

Protein Analysis

62

Amino Acids

6.93

Weight (kDa)

5.47

Isoelectric Point (pI)

40.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Coatomer_E PF04733 2 - 61 4.6e-14 Coatomer epsilon subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 161
AclWI GGATC 2 cut(s) 44, 57
AgsI TTSAA 1 cut(s) 26
AjiI CACGTC 1 cut(s) 148
AjnI CCWGG 1 cut(s) 69
AluBI AGCT 2 cut(s) 170, 184
AluI AGCT 2 cut(s) 170, 184
AlwI GGATC 2 cut(s) 44, 57
AsuHPI GGTGA 1 cut(s) 80
BamHI GGATCC 1 cut(s) 49
BanI GGYRCC 1 cut(s) 161
BarI GAAGNNNNNNTAC 2 cut(s) 69, 101
BbsI GAAGAC 1 cut(s) 77
BbvCI CCTCAGC 1 cut(s) 166
BciT130I CCWGG 1 cut(s) 71
BfaI CTAG 1 cut(s) 62
BfmI CTRYAG 1 cut(s) 171
Bme1390I CCNGG 1 cut(s) 71
BmgBI CACGTC 1 cut(s) 148
BmiI GGNNCC 2 cut(s) 51, 163
BmrFI CCNGG 1 cut(s) 71
BmsI GCATC 1 cut(s) 31
BpiI GAAGAC 1 cut(s) 77
Bpu10I CCTNAGC 1 cut(s) 166
BsaJI CCNNGG 2 cut(s) 29, 91
BseBI CCWGG 1 cut(s) 71
BseDI CCNNGG 2 cut(s) 29, 91
BseGI GGATG 2 cut(s) 46, 136
BseMII CTCAG 1 cut(s) 180
BshNI GGYRCC 1 cut(s) 161
Bsp143I GATC 1 cut(s) 49
Bsp19I CCATGG 1 cut(s) 29
BspCNI CTCAG 1 cut(s) 179
BspLI GGNNCC 2 cut(s) 51, 163
BspPI GGATC 2 cut(s) 44, 57
BspT107I GGYRCC 1 cut(s) 161
BssECI CCNNGG 2 cut(s) 29, 91
BssMI GATC 1 cut(s) 49
BssT1I CCWWGG 2 cut(s) 29, 91
Bst2UI CCWGG 1 cut(s) 71
BstDEI CTNAG 1 cut(s) 166
BstDSI CCRYGG 1 cut(s) 29
BstF5I GGATG 2 cut(s) 46, 136
BstKTI GATC 1 cut(s) 52
BstMBI GATC 1 cut(s) 49
BstNI CCWGG 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 69
BstSFI CTRYAG 1 cut(s) 171
BstV2I GAAGAC 1 cut(s) 77
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BtgI CCRYGG 1 cut(s) 29
BtrI CACGTC 1 cut(s) 148
BtsCI GGATG 2 cut(s) 46, 136
BtsI GCAGTG 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 14
CsiI ACCWGGT 1 cut(s) 69
CviAII CATG 1 cut(s) 30
CviJI RGCY 4 cut(s) 65, 120, 170, 184
CviKI_1 RGCY 4 cut(s) 65, 120, 170, 184
DdeI CTNAG 1 cut(s) 166
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
Eco130I CCWWGG 2 cut(s) 29, 91
EcoRII CCWGG 1 cut(s) 69
EcoT14I CCWWGG 2 cut(s) 29, 91
ErhI CCWWGG 2 cut(s) 29, 91
FaeI CATG 1 cut(s) 33
FaiI YATR 2 cut(s) 31, 79
FatI CATG 1 cut(s) 29
FokI GGATG 2 cut(s) 53, 123
FspBI CTAG 1 cut(s) 62
Hin1II CATG 1 cut(s) 33
HphI GGTGA 1 cut(s) 80
Hpy188III TCNNGA 4 cut(s) 23, 53, 126, 140
HpyAV CCTTC 1 cut(s) 114
HpyCH4IV ACGT 1 cut(s) 147
HpyCH4V TGCA 2 cut(s) 44, 134
HpyF3I CTNAG 1 cut(s) 166
HpySE526I ACGT 1 cut(s) 147
Hsp92II CATG 1 cut(s) 33
Kzo9I GATC 1 cut(s) 49
LpnPI CCDG 4 cut(s) 56, 66, 83, 153
LweI GCATC 1 cut(s) 31
MabI ACCWGGT 1 cut(s) 69
MaeI CTAG 1 cut(s) 62
MaeII ACGT 1 cut(s) 147
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MboII GAAGA 1 cut(s) 77
MflI RGATCY 1 cut(s) 49
MnlI CCTC 3 cut(s) 40, 161, 175
MspA1I CMGCKG 1 cut(s) 170
MspR9I CCNGG 1 cut(s) 71
MvaI CCWGG 1 cut(s) 71
NcoI CCATGG 1 cut(s) 29
NdeII GATC 1 cut(s) 49
NlaIII CATG 1 cut(s) 33
NlaIV GGNNCC 2 cut(s) 51, 163
PflFI GACNNNGTC 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 69
PspGI CCWGG 1 cut(s) 69
PspN4I GGNNCC 2 cut(s) 51, 163
PsuI RGATCY 1 cut(s) 49
PsyI GACNNNGTC 1 cut(s) 146
PvuII CAGCTG 1 cut(s) 170
Sau3AI GATC 1 cut(s) 49
ScrFI CCNGG 1 cut(s) 71
SetI ASST 7 cut(s) 72, 93, 106, 150, 163, 172, 186
SexAI ACCWGGT 1 cut(s) 69
SfaNI GCATC 1 cut(s) 31
SfcI CTRYAG 1 cut(s) 171
SspMI CTAG 1 cut(s) 62
StyD4I CCNGG 1 cut(s) 69
StyI CCWWGG 2 cut(s) 29, 91
TaiI ACGT 1 cut(s) 150
TscAI CASTG 1 cut(s) 21
TspRI CASTG 1 cut(s) 21
Tth111I GACNNNGTC 1 cut(s) 146
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.