Rorug07G0231200

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. The coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
21112558 .. 21113126
569 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0231200.1

Sequence Viewer

Length: 219 bp
ATGGGAAATCTTGGACTTTGTGGACCACCATTAACACAAATTTGTCCAGGTGATGGAACAACTGTAGATGATGGAATTACGAGAGGTGGTGAAACTGATAACAAGGAACATGGAGCTTCTGGTGTTGGGGGGAATGAGCCTAATTACCTTGTAGCTCAAAATTCAAGGCTTAATGTGGGATGTTCCGAGATGTCTTTGCTACCCTTACAGCAGAAATAG

Protein Analysis

72

Amino Acids

7.38

Weight (kDa)

4.5

Isoelectric Point (pI)

29.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 53
AcsI RAATTY 2 cut(s) 39, 160
AfiI CCNNNNNNNGG 1 cut(s) 53
AgsI TTSAA 1 cut(s) 165
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 2 cut(s) 116, 155
AluI AGCT 2 cut(s) 116, 155
ApoI RAATTY 2 cut(s) 39, 160
AspS9I GGNCC 1 cut(s) 23
AsuHPI GGTGA 2 cut(s) 62, 101
AvaII GGWCC 1 cut(s) 23
BccI CCATC 2 cut(s) 47, 65
BciT130I CCWGG 1 cut(s) 48
BfmI CTRYAG 1 cut(s) 63
Bme1390I CCNGG 1 cut(s) 48
Bme18I GGWCC 1 cut(s) 23
BmgT120I GGNCC 1 cut(s) 23
BmrFI CCNGG 1 cut(s) 48
Bsc4I CCNNNNNNNGG 1 cut(s) 53
BseBI CCWGG 1 cut(s) 48
BseGI GGATG 1 cut(s) 185
BseLI CCNNNNNNNGG 1 cut(s) 53
BslI CCNNNNNNNGG 1 cut(s) 53
Bst2UI CCWGG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 64
BstF5I GGATG 1 cut(s) 185
BstNI CCWGG 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 46
BstSFI CTRYAG 1 cut(s) 63
BtsCI GGATG 1 cut(s) 185
Cfr13I GGNCC 1 cut(s) 23
CviAII CATG 1 cut(s) 110
CviJI RGCY 4 cut(s) 116, 139, 155, 169
CviKI_1 RGCY 4 cut(s) 116, 139, 155, 169
Eco47I GGWCC 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 46
FaeI CATG 1 cut(s) 113
FaiI YATR 1 cut(s) 111
FatI CATG 1 cut(s) 109
FokI GGATG 1 cut(s) 192
Hin1II CATG 1 cut(s) 113
HphI GGTGA 2 cut(s) 62, 101
Hpy166II GTNNAC 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 187
Hpy8I GTNNAC 1 cut(s) 23
HpyCH4III ACNGT 1 cut(s) 64
Hsp92II CATG 1 cut(s) 113
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 3 cut(s) 33, 60, 105
MluCI AATT 4 cut(s) 39, 75, 142, 160
MnlI CCTC 1 cut(s) 77
MseI TTAA 2 cut(s) 32, 171
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
NlaIII CATG 1 cut(s) 113
PflMI CCANNNNNTGG 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PspPI GGNCC 1 cut(s) 23
SaqAI TTAA 2 cut(s) 32, 171
Sau96I GGNCC 1 cut(s) 23
ScrFI CCNGG 1 cut(s) 48
SetI ASST 5 cut(s) 52, 88, 118, 150, 157
SfcI CTRYAG 1 cut(s) 63
SinI GGWCC 1 cut(s) 23
Sse9I AATT 4 cut(s) 39, 75, 142, 160
StyD4I CCNGG 1 cut(s) 46
TaaI ACNGT 1 cut(s) 64
TasI AATT 4 cut(s) 39, 75, 142, 160
Tru1I TTAA 2 cut(s) 32, 171
Tru9I TTAA 2 cut(s) 32, 171
Van91I CCANNNNNTGG 1 cut(s) 53
VpaK11BI GGWCC 1 cut(s) 23
XapI RAATTY 2 cut(s) 39, 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.