Rh6BG475400

Clathrin is the major protein of the polyhedral coat of coated pits and vesicles

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
68180767 .. 68181794
1028 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG475400.1

Sequence Viewer

Length: 156 bp
ATGTCTTCGCTCGCCTCGATCTACTCCACCATCGAGTCCGACATTGAAGCTGTTCTTCAGCTTCCGAGTGTTGAGATTAATCCGCAATTCATAACATTTATGCATGTTACTATGGAGTCCAATAAGTACACATGTGTTCGGGAAACAATGCCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

51

Amino Acids

5.78

Weight (kDa)

4.41

Isoelectric Point (pI)

88.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 83
AcuI CTGAAG 1 cut(s) 41
AfaI GTAC 1 cut(s) 128
AflIII ACRYGT 1 cut(s) 131
AgsI TTSAA 1 cut(s) 47
AluBI AGCT 2 cut(s) 50, 61
AluI AGCT 2 cut(s) 50, 61
AseI ATTAAT 1 cut(s) 78
Asp700I GAANNNNTTC 1 cut(s) 51
BccI CCATC 1 cut(s) 38
BceAI ACGGC 1 cut(s) 136
Bsp143I GATC 1 cut(s) 18
BspACI CCGC 1 cut(s) 83
BssMI GATC 1 cut(s) 18
BstC8I GCNNGC 1 cut(s) 12
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstNSI RCATGY 2 cut(s) 107, 135
Cac8I GCNNGC 1 cut(s) 12
Csp6I GTAC 1 cut(s) 127
CviAII CATG 2 cut(s) 104, 132
CviJI RGCY 2 cut(s) 50, 61
CviKI_1 RGCY 2 cut(s) 50, 61
CviQI GTAC 1 cut(s) 127
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
Eco57I CTGAAG 1 cut(s) 41
EcoT22I ATGCAT 1 cut(s) 105
FaeI CATG 2 cut(s) 107, 135
FaiI YATR 5 cut(s) 92, 101, 105, 113, 133
FalI AAGNNNNNCTT 2 cut(s) 39, 71
FatI CATG 2 cut(s) 103, 131
Hin1II CATG 2 cut(s) 107, 135
HinfI GANTC 2 cut(s) 35, 116
Hpy166II GTNNAC 1 cut(s) 129
Hpy188I TCNGA 2 cut(s) 40, 66
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 1 cut(s) 129
HpyCH4V TGCA 1 cut(s) 103
Hsp92II CATG 2 cut(s) 107, 135
Kzo9I GATC 1 cut(s) 18
MaeIII GTNAC 1 cut(s) 106
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MboII GAAGA 1 cut(s) 47
MluCI AATT 1 cut(s) 86
MlyI GAGTC 2 cut(s) 44, 125
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 1 cut(s) 25
Mph1103I ATGCAT 1 cut(s) 105
MroXI GAANNNNTTC 1 cut(s) 51
MseI TTAA 1 cut(s) 78
NdeII GATC 1 cut(s) 18
NlaIII CATG 2 cut(s) 107, 135
NsiI ATGCAT 1 cut(s) 105
NspI RCATGY 2 cut(s) 107, 135
PciI ACATGT 1 cut(s) 131
PcsI WCGNNNNNNNCGW 1 cut(s) 14
PdmI GAANNNNTTC 1 cut(s) 51
PleI GAGTC 2 cut(s) 43, 124
PpsI GAGTC 2 cut(s) 43, 124
PscI ACATGT 1 cut(s) 131
PshBI ATTAAT 1 cut(s) 78
RsaI GTAC 1 cut(s) 128
RsaNI GTAC 1 cut(s) 127
SaqAI TTAA 1 cut(s) 78
Sau3AI GATC 1 cut(s) 18
SchI GAGTC 2 cut(s) 44, 125
SetI ASST 2 cut(s) 52, 63
SgeI CNNG 7 cut(s) 23, 28, 46, 78, 116, 144, 152
Sse9I AATT 1 cut(s) 86
SsiI CCGC 1 cut(s) 83
TaqI TCGA 2 cut(s) 17, 33
TasI AATT 1 cut(s) 86
TatI WGTACW 1 cut(s) 126
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TspDTI ATGAA 1 cut(s) 79
VspI ATTAAT 1 cut(s) 78
XceI RCATGY 2 cut(s) 107, 135
XmnI GAANNNNTTC 1 cut(s) 51
Zsp2I ATGCAT 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.