RchiOBHm_Chr6g0289621

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. The coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
52667377 .. 52668104
728 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25982

Sequence Viewer

Length: 213 bp
ATGGAAAGGGAAACACTGCTTCTTGAAGCATGGAACAAGGATGCAGAGGATCCAGAAACTCTAGCCAACCTGGTCGTATGCTGTATTCACCTTGGAAACCTACCTTCTCGTTTTGTCAGCCAATCAAGACTTGCACATCTAGACCACGTCCTCGTCAAAGGTGCCTCAACTGTAGAAGAGAGCTTTGACAGAGCTCTTCAATCAGTTGCTTGA

Protein Analysis

70

Amino Acids

7.77

Weight (kDa)

4.93

Isoelectric Point (pI)

55.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Coatomer_E PF04733 2 - 69 1.7e-16 Coatomer epsilon subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 161
AclWI GGATC 2 cut(s) 44, 57
AgsI TTSAA 2 cut(s) 26, 200
AjiI CACGTC 1 cut(s) 148
AjnI CCWGG 1 cut(s) 69
AluBI AGCT 2 cut(s) 183, 194
AluI AGCT 2 cut(s) 183, 194
Alw21I GWGCWC 1 cut(s) 196
AlwI GGATC 2 cut(s) 44, 57
AsuHPI GGTGA 1 cut(s) 80
BamHI GGATCC 1 cut(s) 49
BanI GGYRCC 1 cut(s) 161
BanII GRGCYC 1 cut(s) 196
Bbv12I GWGCWC 1 cut(s) 196
BciT130I CCWGG 1 cut(s) 71
BfaI CTAG 2 cut(s) 62, 140
BfmI CTRYAG 1 cut(s) 171
Bme1390I CCNGG 1 cut(s) 71
BmgBI CACGTC 1 cut(s) 148
BmiI GGNNCC 2 cut(s) 51, 163
BmrFI CCNGG 1 cut(s) 71
BmsI GCATC 1 cut(s) 31
BsaJI CCNNGG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 71
BseDI CCNNGG 1 cut(s) 91
BseGI GGATG 1 cut(s) 46
BshNI GGYRCC 1 cut(s) 161
BsiHKAI GWGCWC 1 cut(s) 196
Bsp1286I GDGCHC 1 cut(s) 196
Bsp143I GATC 1 cut(s) 49
BspLI GGNNCC 2 cut(s) 51, 163
BspPI GGATC 2 cut(s) 44, 57
BspQI GCTCTTC 1 cut(s) 201
BspT107I GGYRCC 1 cut(s) 161
BssECI CCNNGG 1 cut(s) 91
BssMI GATC 1 cut(s) 49
BssT1I CCWWGG 1 cut(s) 91
Bst2UI CCWGG 1 cut(s) 71
Bst4CI ACNGT 1 cut(s) 172
Bst6I CTCTTC 2 cut(s) 171, 201
BstF5I GGATG 1 cut(s) 46
BstKTI GATC 1 cut(s) 52
BstMBI GATC 1 cut(s) 49
BstNI CCWGG 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 69
BstSFI CTRYAG 1 cut(s) 171
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BtrI CACGTC 1 cut(s) 148
BtsCI GGATG 1 cut(s) 46
BtsI GCAGTG 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 14
CsiI ACCWGGT 1 cut(s) 69
CviAII CATG 1 cut(s) 30
CviJI RGCY 4 cut(s) 65, 120, 183, 194
CviKI_1 RGCY 4 cut(s) 65, 120, 183, 194
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
Eam1104I CTCTTC 2 cut(s) 171, 201
EarI CTCTTC 2 cut(s) 171, 201
Ecl136II GAGCTC 1 cut(s) 194
Eco130I CCWWGG 1 cut(s) 91
Eco24I GRGCYC 1 cut(s) 196
Eco53kI GAGCTC 1 cut(s) 194
EcoICRI GAGCTC 1 cut(s) 194
EcoRII CCWGG 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 91
EcoT38I GRGCYC 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 91
FaeI CATG 1 cut(s) 33
FaiI YATR 2 cut(s) 31, 79
FatI CATG 1 cut(s) 29
FokI GGATG 1 cut(s) 53
FriOI GRGCYC 1 cut(s) 196
FspBI CTAG 2 cut(s) 62, 140
Hin1II CATG 1 cut(s) 33
HphI GGTGA 1 cut(s) 80
Hpy188III TCNNGA 4 cut(s) 23, 53, 126, 140
HpyAV CCTTC 1 cut(s) 114
HpyCH4III ACNGT 1 cut(s) 172
HpyCH4IV ACGT 1 cut(s) 147
HpyCH4V TGCA 2 cut(s) 44, 134
HpySE526I ACGT 1 cut(s) 147
Hsp92II CATG 1 cut(s) 33
Kzo9I GATC 1 cut(s) 49
LguI GCTCTTC 1 cut(s) 201
LpnPI CCDG 3 cut(s) 56, 66, 83
LweI GCATC 1 cut(s) 31
MabI ACCWGGT 1 cut(s) 69
MaeI CTAG 2 cut(s) 62, 140
MaeII ACGT 1 cut(s) 147
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MboII GAAGA 2 cut(s) 188, 188
MflI RGATCY 1 cut(s) 49
MhlI GDGCHC 1 cut(s) 196
MnlI CCTC 3 cut(s) 40, 161, 175
MspR9I CCNGG 1 cut(s) 71
MvaI CCWGG 1 cut(s) 71
NdeII GATC 1 cut(s) 49
NlaIII CATG 1 cut(s) 33
NlaIV GGNNCC 2 cut(s) 51, 163
PciSI GCTCTTC 1 cut(s) 201
PflFI GACNNNGTC 1 cut(s) 146
Psp124BI GAGCTC 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 69
PspGI CCWGG 1 cut(s) 69
PspN4I GGNNCC 2 cut(s) 51, 163
PsuI RGATCY 1 cut(s) 49
PsyI GACNNNGTC 1 cut(s) 146
SacI GAGCTC 1 cut(s) 196
SapI GCTCTTC 1 cut(s) 201
Sau3AI GATC 1 cut(s) 49
ScrFI CCNGG 1 cut(s) 71
SduI GDGCHC 1 cut(s) 196
SetI ASST 8 cut(s) 72, 93, 102, 106, 150, 163, 185, 196
SexAI ACCWGGT 1 cut(s) 69
SfaNI GCATC 1 cut(s) 31
SfcI CTRYAG 1 cut(s) 171
SspMI CTAG 2 cut(s) 62, 140
SstI GAGCTC 1 cut(s) 196
StyD4I CCNGG 1 cut(s) 69
StyI CCWWGG 1 cut(s) 91
TaaI ACNGT 1 cut(s) 172
TaiI ACGT 1 cut(s) 150
TscAI CASTG 1 cut(s) 21
TspRI CASTG 1 cut(s) 21
Tth111I GACNNNGTC 1 cut(s) 146
XbaI TCTAGA 1 cut(s) 139
XspI CTAG 2 cut(s) 62, 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.