RchiOBHm_Chr1g0317791
BZIP Family

G-box-binding factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
5336368 .. 5336947
580 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54808

Sequence Viewer

Length: 174 bp
ATGGCGCAGATGGGAAAGAGCGAGCTAGCTTCAGCCAAAAAACCCAAGGGAGCTGCAGGAAATACAGGTTTGGTTAGTGGCAAGGCTGGGGAGAGTGGAAAAGCAACTTCTGGTTCTGGAATGATGGAGTTTCACAAAGGTCAGTGGTCCTTGCATTGTATTCTTAGTGAATGA

Protein Analysis

57

Amino Acids

5.77

Weight (kDa)

9.36

Isoelectric Point (pI)

13.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 15
AluBI AGCT 3 cut(s) 25, 29, 53
AluI AGCT 3 cut(s) 25, 29, 53
ApeKI GCWGC 1 cut(s) 53
AspLEI GCGC 1 cut(s) 7
AspS9I GGNCC 1 cut(s) 147
AsuNHI GCTAGC 1 cut(s) 25
AvaII GGWCC 1 cut(s) 147
BbvI GCAGC 1 cut(s) 40
BccI CCATC 2 cut(s) 4, 118
BfaI CTAG 1 cut(s) 26
BfmI CTRYAG 1 cut(s) 54
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
Bme18I GGWCC 1 cut(s) 147
BmgT120I GGNCC 1 cut(s) 147
BmtI GCTAGC 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 45
BseXI GCAGC 1 cut(s) 40
BseYI CCCAGC 1 cut(s) 86
BspMAI CTGCAG 1 cut(s) 58
BspOI GCTAGC 1 cut(s) 29
BssECI CCNNGG 1 cut(s) 45
BssT1I CCWWGG 1 cut(s) 45
BstC8I GCNNGC 2 cut(s) 23, 27
BstDEI CTNAG 1 cut(s) 164
BstHHI GCGC 1 cut(s) 7
BstSFI CTRYAG 1 cut(s) 54
BstV1I GCAGC 1 cut(s) 40
BtsIMutI CAGTG 1 cut(s) 149
Cac8I GCNNGC 2 cut(s) 23, 27
CfoI GCGC 1 cut(s) 7
Cfr13I GGNCC 1 cut(s) 147
CviJI RGCY 5 cut(s) 25, 29, 35, 53, 86
CviKI_1 RGCY 5 cut(s) 25, 29, 35, 53, 86
DdeI CTNAG 1 cut(s) 164
Eco130I CCWWGG 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 147
Eco57I CTGAAG 1 cut(s) 15
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 1 cut(s) 26
GlaI GCGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 54
GsaI CCCAGC 1 cut(s) 90
HhaI GCGC 1 cut(s) 7
Hin6I GCGC 1 cut(s) 5
HinP1I GCGC 1 cut(s) 5
Hpy188III TCNNGA 1 cut(s) 117
HpyCH4V TGCA 2 cut(s) 56, 154
HpyF3I CTNAG 1 cut(s) 164
HspAI GCGC 1 cut(s) 5
LmnI GCTCC 1 cut(s) 50
LpnPI CCDG 5 cut(s) 42, 51, 72, 96, 102
Lsp1109I GCAGC 1 cut(s) 40
MaeI CTAG 1 cut(s) 26
NheI GCTAGC 1 cut(s) 25
PkrI GCNGC 1 cut(s) 55
PspFI CCCAGC 1 cut(s) 86
PspPI GGNCC 1 cut(s) 147
PstI CTGCAG 1 cut(s) 58
SatI GCNGC 1 cut(s) 54
Sau96I GGNCC 1 cut(s) 147
SetI ASST 5 cut(s) 27, 31, 55, 70, 142
SfcI CTRYAG 1 cut(s) 54
SinI GGWCC 1 cut(s) 147
SspMI CTAG 1 cut(s) 26
StyI CCWWGG 1 cut(s) 45
TscAI CASTG 1 cut(s) 149
TseI GCWGC 1 cut(s) 53
TspRI CASTG 1 cut(s) 149
VpaK11BI GGWCC 1 cut(s) 147
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.