Rroxscaffold_5G00346870

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0001190
Physical Location & Seq
Reverse (-)
17897735 .. 17901577
3843 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00346870.1

Sequence Viewer

Length: 153 bp
ATGGGAAAGAGCGAGCTAGCTTCAGCCAAAAAACCCAAGGGAGCTGCAGGAAATACAGGTTTGGTTAGTGGCAAGGCAGGGGAGAGTGGAAAAGCAACTTCTGGTTCTGGAATGATGGAGTTTCACAAAGGCTCTCCTCCTGGTTTTAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

4.88

Weight (kDa)

10.12

Isoelectric Point (pI)

16.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 6
AjnI CCWGG 1 cut(s) 139
AluBI AGCT 3 cut(s) 16, 20, 44
AluI AGCT 3 cut(s) 16, 20, 44
ApeKI GCWGC 1 cut(s) 44
AsuNHI GCTAGC 1 cut(s) 16
BbvI GCAGC 1 cut(s) 31
BccI CCATC 1 cut(s) 109
BciT130I CCWGG 1 cut(s) 141
BfaI CTAG 1 cut(s) 17
BfmI CTRYAG 1 cut(s) 45
BisI GCNGC 1 cut(s) 45
BlsI GCNGC 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 141
BmrFI CCNGG 1 cut(s) 141
BmtI GCTAGC 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 36
BseBI CCWGG 1 cut(s) 141
BseDI CCNNGG 1 cut(s) 36
BseRI GAGGAG 1 cut(s) 126
BseXI GCAGC 1 cut(s) 31
BspMAI CTGCAG 1 cut(s) 49
BspOI GCTAGC 1 cut(s) 20
BssECI CCNNGG 1 cut(s) 36
BssT1I CCWWGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 141
BstC8I GCNNGC 2 cut(s) 14, 18
BstNI CCWGG 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 139
BstSFI CTRYAG 1 cut(s) 45
BstV1I GCAGC 1 cut(s) 31
Cac8I GCNNGC 2 cut(s) 14, 18
CviJI RGCY 5 cut(s) 16, 20, 26, 44, 132
CviKI_1 RGCY 5 cut(s) 16, 20, 26, 44, 132
Eco130I CCWWGG 1 cut(s) 36
Eco57I CTGAAG 1 cut(s) 6
EcoRII CCWGG 1 cut(s) 139
EcoT14I CCWWGG 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 36
Fnu4HI GCNGC 1 cut(s) 45
Fsp4HI GCNGC 1 cut(s) 45
FspBI CTAG 1 cut(s) 17
GluI GCNGC 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 108
HpyCH4V TGCA 1 cut(s) 47
LmnI GCTCC 1 cut(s) 41
LpnPI CCDG 6 cut(s) 33, 42, 63, 87, 93, 126
Lsp1109I GCAGC 1 cut(s) 31
MaeI CTAG 1 cut(s) 17
MnlI CCTC 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 141
NheI GCTAGC 1 cut(s) 16
PkrI GCNGC 1 cut(s) 46
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
PstI CTGCAG 1 cut(s) 49
SatI GCNGC 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 141
SetI ASST 4 cut(s) 18, 22, 46, 61
SfcI CTRYAG 1 cut(s) 45
SgeI CNNG 9 cut(s) 25, 29, 49, 60, 69, 85, 90, 114, 120
SspMI CTAG 1 cut(s) 17
StyD4I CCNGG 1 cut(s) 139
StyI CCWWGG 1 cut(s) 36
TseI GCWGC 1 cut(s) 44
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.