RchiOBHm_Chr1g0326001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001802
Physical Location & Seq
Reverse (-)
14167841 .. 14172623
4783 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55565

Sequence Viewer

Length: 183 bp
ATGGGCATCCCTCAAGTCTCCATTGAAACTGGGGCCAACGACCACAGGGCAACCACGACCGATTATCGGACCCTAATCTCAAATTCAGCAGCAGATCGAGGTGCATTTGAAGAAAACGCTAATTTCAGTAGCGGCGTTGCACTTGAAGAAAACCATGATAGGCCATCTAACAATCATCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.48

Weight (kDa)

4.8

Isoelectric Point (pI)

22.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 132
AcsI RAATTY 1 cut(s) 82
AfiI CCNNNNNNNGG 1 cut(s) 66
AgsI TTSAA 3 cut(s) 26, 110, 146
Alw26I GTCTC 1 cut(s) 22
AoxI GGCC 2 cut(s) 33, 161
ApeKI GCWGC 1 cut(s) 89
ApoI RAATTY 1 cut(s) 82
AspS9I GGNCC 2 cut(s) 33, 69
AvaII GGWCC 1 cut(s) 69
BbvI GCAGC 1 cut(s) 101
BccI CCATC 1 cut(s) 172
BcoDI GTCTC 1 cut(s) 22
BisI GCNGC 2 cut(s) 90, 133
BlsI GCNGC 2 cut(s) 91, 134
Bme18I GGWCC 1 cut(s) 69
BmgT120I GGNCC 2 cut(s) 33, 69
BmiI GGNNCC 2 cut(s) 34, 71
BmrI ACTGGG 1 cut(s) 39
BmsI GCATC 1 cut(s) 15
BmuI ACTGGG 1 cut(s) 39
Bsc4I CCNNNNNNNGG 1 cut(s) 66
Bse1I ACTGG 1 cut(s) 34
BseGI GGATG 2 cut(s) 6, 175
BseLI CCNNNNNNNGG 1 cut(s) 66
BseNI ACTGG 1 cut(s) 34
BseXI GCAGC 1 cut(s) 101
Bsh1285I CGRYCG 1 cut(s) 60
BshFI GGCC 2 cut(s) 35, 163
BsiEI CGRYCG 1 cut(s) 60
BslI CCNNNNNNNGG 1 cut(s) 66
BsmAI GTCTC 1 cut(s) 22
BsnI GGCC 2 cut(s) 35, 163
Bsp143I GATC 1 cut(s) 94
BspACI CCGC 1 cut(s) 132
BspANI GGCC 2 cut(s) 35, 163
BspLI GGNNCC 2 cut(s) 34, 71
BsrI ACTGG 1 cut(s) 34
BssMI GATC 1 cut(s) 94
BstF5I GGATG 2 cut(s) 6, 175
BstKTI GATC 1 cut(s) 97
BstMAI GTCTC 1 cut(s) 22
BstMBI GATC 1 cut(s) 94
BstMCI CGRYCG 1 cut(s) 60
BstV1I GCAGC 1 cut(s) 101
BsuRI GGCC 2 cut(s) 35, 163
BtsCI GGATG 2 cut(s) 6, 175
Cfr13I GGNCC 2 cut(s) 33, 69
CviAII CATG 2 cut(s) 155, 180
CviJI RGCY 2 cut(s) 35, 163
CviKI_1 RGCY 2 cut(s) 35, 163
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 69
FaeI CATG 2 cut(s) 158, 183
FaiI YATR 2 cut(s) 156, 181
FatI CATG 2 cut(s) 154, 179
Fnu4HI GCNGC 2 cut(s) 90, 133
FokI GGATG 1 cut(s) 162
Fsp4HI GCNGC 2 cut(s) 90, 133
GluI GCNGC 2 cut(s) 90, 133
HaeIII GGCC 2 cut(s) 35, 163
Hin1II CATG 2 cut(s) 158, 183
Hpy188I TCNGA 1 cut(s) 69
HpyCH4V TGCA 2 cut(s) 104, 140
Hsp92II CATG 2 cut(s) 158, 183
Kzo9I GATC 1 cut(s) 94
LpnPI CCDG 2 cut(s) 15, 31
Lsp1109I GCAGC 1 cut(s) 101
LweI GCATC 1 cut(s) 15
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MboII GAAGA 2 cut(s) 122, 158
MluCI AATT 2 cut(s) 82, 121
MnlI CCTC 2 cut(s) 21, 92
NdeII GATC 1 cut(s) 94
NlaIII CATG 2 cut(s) 158, 183
NlaIV GGNNCC 2 cut(s) 34, 71
PkrI GCNGC 2 cut(s) 91, 134
PspN4I GGNNCC 2 cut(s) 34, 71
PspPI GGNCC 2 cut(s) 33, 69
SatI GCNGC 2 cut(s) 90, 133
Sau3AI GATC 1 cut(s) 94
Sau96I GGNCC 2 cut(s) 33, 69
SetI ASST 1 cut(s) 103
SfaNI GCATC 1 cut(s) 15
SgeI CNNG 7 cut(s) 26, 42, 58, 67, 110, 155, 167
SinI GGWCC 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
Sse9I AATT 2 cut(s) 82, 121
SsiI CCGC 1 cut(s) 132
TaqI TCGA 1 cut(s) 97
TaqII GACCGA 1 cut(s) 74
TasI AATT 2 cut(s) 82, 121
TauI GCSGC 1 cut(s) 135
TseI GCWGC 1 cut(s) 89
VpaK11BI GGWCC 1 cut(s) 69
XapI RAATTY 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.