Rmu_co8081816.1_g000001

pyridoxal biosynthesis protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8081816.1
Physical Location & Seq
Forward (+)
1 .. 390
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8081816.1_g000001.1.cds

Sequence Viewer

Length: 242 bp
ctttgcctccgaccaatatggccctcgtcggcgtgcttgctttacagggctcttacaacgaacacatagcagtgctgagaaggctgggagtgaagggcgtggagataaagaaaccagagcagctcgaaaacttggcctcactcataatccctggaggagagagcaccaccatggctaagctcgccgagtaccacaacctggtctctctatcactcaccaaaacagtctctgtcatttgttga

Protein Analysis

79

Amino Acids

8.44

Weight (kDa)

8.12

Isoelectric Point (pI)

43.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 198
AfaI GTAC 1 cut(s) 190
AfiI CCNNNNNNNGG 1 cut(s) 198
AjnI CCWGG 2 cut(s) 150, 197
AluBI AGCT 2 cut(s) 123, 180
AluI AGCT 2 cut(s) 123, 180
Alw21I GWGCWC 1 cut(s) 166
Alw26I GTCTC 2 cut(s) 207, 231
AlwNI CAGNNNCTG 1 cut(s) 229
AoxI GGCC 2 cut(s) 20, 134
ApeKI GCWGC 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 21
AsuHPI GGTGA 1 cut(s) 207
BanII GRGCYC 1 cut(s) 52
Bbv12I GWGCWC 1 cut(s) 166
BbvI GCAGC 1 cut(s) 132
BciT130I CCWGG 2 cut(s) 152, 199
BcoDI GTCTC 2 cut(s) 207, 231
BisI GCNGC 1 cut(s) 121
BlpI GCTNAGC 1 cut(s) 176
BlsI GCNGC 1 cut(s) 122
Bme1390I CCNGG 2 cut(s) 152, 199
BmgT120I GGNCC 1 cut(s) 21
BmrFI CCNGG 2 cut(s) 152, 199
BpmI CTGGAG 1 cut(s) 173
Bpu1102I GCTNAGC 1 cut(s) 176
BsaI GGTCTC 1 cut(s) 207
BsaJI CCNNGG 2 cut(s) 150, 170
Bsc4I CCNNNNNNNGG 1 cut(s) 198
BseBI CCWGG 2 cut(s) 152, 199
BseDI CCNNGG 2 cut(s) 150, 170
BseLI CCNNNNNNNGG 1 cut(s) 198
BseMII CTCAG 1 cut(s) 67
BseRI GAGGAG 1 cut(s) 170
BseXI GCAGC 1 cut(s) 132
BseYI CCCAGC 1 cut(s) 84
BshFI GGCC 2 cut(s) 22, 136
BsiHKAI GWGCWC 1 cut(s) 166
BslI CCNNNNNNNGG 1 cut(s) 198
BsmAI GTCTC 2 cut(s) 207, 231
BsnI GGCC 2 cut(s) 22, 136
Bso31I GGTCTC 1 cut(s) 207
Bsp1286I GDGCHC 2 cut(s) 52, 166
Bsp1720I GCTNAGC 1 cut(s) 176
Bsp19I CCATGG 1 cut(s) 170
BspANI GGCC 2 cut(s) 22, 136
BspCNI CTCAG 1 cut(s) 68
BspTNI GGTCTC 1 cut(s) 207
BssECI CCNNGG 2 cut(s) 150, 170
BssT1I CCWWGG 1 cut(s) 170
Bst2UI CCWGG 2 cut(s) 152, 199
Bst4CI ACNGT 1 cut(s) 225
BstC8I GCNNGC 3 cut(s) 34, 38, 182
BstDEI CTNAG 2 cut(s) 76, 176
BstDSI CCRYGG 1 cut(s) 170
BstMAI GTCTC 2 cut(s) 207, 231
BstMWI GCNNNNNNNGC 2 cut(s) 81, 181
BstNI CCWGG 2 cut(s) 152, 199
BstSCI CCNGG 2 cut(s) 150, 197
BstV1I GCAGC 1 cut(s) 132
BsuRI GGCC 2 cut(s) 22, 136
BtgI CCRYGG 1 cut(s) 170
BtsI GCAGTG 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 77
Cac8I GCNNGC 3 cut(s) 34, 38, 182
CaiI CAGNNNCTG 1 cut(s) 229
Cfr13I GGNCC 1 cut(s) 21
CsiI ACCWGGT 1 cut(s) 197
Csp6I GTAC 1 cut(s) 189
CviAII CATG 1 cut(s) 171
CviJI RGCY 7 cut(s) 22, 50, 84, 123, 136, 175, 180
CviKI_1 RGCY 7 cut(s) 22, 50, 84, 123, 136, 175, 180
CviQI GTAC 1 cut(s) 189
DdeI CTNAG 2 cut(s) 76, 176
Eco130I CCWWGG 1 cut(s) 170
Eco24I GRGCYC 1 cut(s) 52
Eco31I GGTCTC 1 cut(s) 207
EcoRII CCWGG 2 cut(s) 150, 197
EcoT14I CCWWGG 1 cut(s) 170
EcoT38I GRGCYC 1 cut(s) 52
ErhI CCWWGG 1 cut(s) 170
FaeI CATG 1 cut(s) 174
FaiI YATR 4 cut(s) 19, 67, 145, 172
FatI CATG 1 cut(s) 170
Fnu4HI GCNGC 1 cut(s) 121
FriOI GRGCYC 1 cut(s) 52
Fsp4HI GCNGC 1 cut(s) 121
GluI GCNGC 1 cut(s) 121
GsaI CCCAGC 1 cut(s) 88
GsuI CTGGAG 1 cut(s) 173
HaeIII GGCC 2 cut(s) 22, 136
Hin1II CATG 1 cut(s) 174
HphI GGTGA 1 cut(s) 207
Hpy188I TCNGA 1 cut(s) 11
Hpy99I CGWCG 1 cut(s) 31
HpyAV CCTTC 2 cut(s) 74, 87
HpyCH4III ACNGT 1 cut(s) 225
HpyF10VI GCNNNNNNNGC 2 cut(s) 81, 181
HpyF3I CTNAG 2 cut(s) 76, 176
Hsp92II CATG 1 cut(s) 174
LpnPI CCDG 7 cut(s) 31, 70, 128, 137, 164, 184, 211
Lsp1109I GCAGC 1 cut(s) 132
MabI ACCWGGT 1 cut(s) 197
MhlI GDGCHC 2 cut(s) 52, 166
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 4 cut(s) 17, 34, 147, 148
MslI CAYNNNNRTG 2 cut(s) 70, 169
MspR9I CCNGG 2 cut(s) 152, 199
MvaI CCWGG 2 cut(s) 152, 199
MwoI GCNNNNNNNGC 2 cut(s) 81, 181
NcoI CCATGG 1 cut(s) 170
NlaIII CATG 1 cut(s) 174
NmeAIII GCCGAG 1 cut(s) 210
PflMI CCANNNNNTGG 1 cut(s) 198
PkrI GCNGC 1 cut(s) 122
Psp6I CCWGG 2 cut(s) 150, 197
PspFI CCCAGC 1 cut(s) 84
PspGI CCWGG 2 cut(s) 150, 197
PspPI GGNCC 1 cut(s) 21
PstNI CAGNNNCTG 1 cut(s) 229
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
RseI CAYNNNNRTG 2 cut(s) 70, 169
SatI GCNGC 1 cut(s) 121
Sau96I GGNCC 1 cut(s) 21
ScrFI CCNGG 2 cut(s) 152, 199
SduI GDGCHC 2 cut(s) 52, 166
SetI ASST 3 cut(s) 125, 182, 200
SexAI ACCWGGT 1 cut(s) 197
SmiMI CAYNNNNRTG 2 cut(s) 70, 169
StyD4I CCNGG 2 cut(s) 150, 197
StyI CCWWGG 1 cut(s) 170
TaaI ACNGT 1 cut(s) 225
TaqI TCGA 1 cut(s) 125
TscAI CASTG 1 cut(s) 77
TseI GCWGC 1 cut(s) 120
TspRI CASTG 1 cut(s) 77
Van91I CCANNNNNTGG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.