RchiOBHm_Chr2g0117801

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0002552
Physical Location & Seq
Forward (+)
30105710 .. 30107891
2182 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49068

Sequence Viewer

Length: 198 bp
ATGGAGGAGGACCCTAGGTTAGGGTTTGAGTTTTTGGGAGCTATCTGCTCGAAATTGGTGACAGTGGCGTCGATGCTCAGCTCCGGTGACATTTCTGATAGCTACAGCTCCGGCCTTGGATCGATAACTGATCGCTTAGGGTTCCGGTCCTCCCATTCGCTCTCAAATTTCCTTCAATGTTGTGATTCGATCGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

6.91

Weight (kDa)

4.45

Isoelectric Point (pI)

37.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 67
AclWI GGATC 1 cut(s) 127
AcsI RAATTY 1 cut(s) 166
AcyI GRCGYC 1 cut(s) 68
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 1 cut(s) 176
AluBI AGCT 4 cut(s) 41, 81, 102, 108
AluI AGCT 4 cut(s) 41, 81, 102, 108
AlwI GGATC 1 cut(s) 127
AoxI GGCC 1 cut(s) 112
ApoI RAATTY 1 cut(s) 166
AspA2I CCTAGG 1 cut(s) 14
AspS9I GGNCC 2 cut(s) 10, 147
AsuHPI GGTGA 2 cut(s) 70, 98
AvaII GGWCC 2 cut(s) 10, 147
AvrII CCTAGG 1 cut(s) 14
BfaI CTAG 1 cut(s) 15
BfmI CTRYAG 1 cut(s) 103
BlnI CCTAGG 1 cut(s) 14
BlpI GCTNAGC 1 cut(s) 77
Bme18I GGWCC 2 cut(s) 10, 147
BmgT120I GGNCC 2 cut(s) 10, 147
BmiI GGNNCC 2 cut(s) 12, 143
BmsI GCATC 1 cut(s) 63
Bpu10I CCTNAGC 1 cut(s) 136
Bpu1102I GCTNAGC 1 cut(s) 77
Bsa29I ATCGAT 1 cut(s) 122
BsaHI GRCGYC 1 cut(s) 68
BsaJI CCNNGG 2 cut(s) 14, 115
BsaWI WCCGGW 2 cut(s) 83, 144
Bsc4I CCNNNNNNNGG 1 cut(s) 20
BseCI ATCGAT 1 cut(s) 122
BseDI CCNNGG 2 cut(s) 14, 115
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMII CTCAG 1 cut(s) 91
BseRI GAGGAG 1 cut(s) 20
Bsh1285I CGRYCG 1 cut(s) 192
BshFI GGCC 1 cut(s) 114
BshVI ATCGAT 1 cut(s) 122
BsiEI CGRYCG 1 cut(s) 192
BsiSI CCGG 3 cut(s) 84, 111, 145
BslI CCNNNNNNNGG 1 cut(s) 20
BsnI GGCC 1 cut(s) 114
Bsp143I GATC 3 cut(s) 119, 130, 189
Bsp1720I GCTNAGC 1 cut(s) 77
BspANI GGCC 1 cut(s) 114
BspCNI CTCAG 1 cut(s) 90
BspDI ATCGAT 1 cut(s) 122
BspLI GGNNCC 2 cut(s) 12, 143
BspPI GGATC 1 cut(s) 127
BssECI CCNNGG 2 cut(s) 14, 115
BssMI GATC 3 cut(s) 119, 130, 189
BssNI GRCGYC 1 cut(s) 68
BssT1I CCWWGG 2 cut(s) 14, 115
Bst4CI ACNGT 1 cut(s) 64
BstACI GRCGYC 1 cut(s) 68
BstDEI CTNAG 2 cut(s) 77, 136
BstENI CCTNNNNNAGG 1 cut(s) 18
BstKTI GATC 3 cut(s) 122, 133, 192
BstMBI GATC 3 cut(s) 119, 130, 189
BstMCI CGRYCG 1 cut(s) 192
BstSFI CTRYAG 1 cut(s) 103
Bsu15I ATCGAT 1 cut(s) 122
BsuRI GGCC 1 cut(s) 114
BsuTUI ATCGAT 1 cut(s) 122
BtsIMutI CAGTG 1 cut(s) 69
Cfr13I GGNCC 2 cut(s) 10, 147
ClaI ATCGAT 1 cut(s) 122
CseI GACGC 1 cut(s) 57
CviJI RGCY 5 cut(s) 41, 81, 102, 108, 114
CviKI_1 RGCY 5 cut(s) 41, 81, 102, 108, 114
DdeI CTNAG 2 cut(s) 77, 136
DpnI GATC 3 cut(s) 121, 132, 191
DpnII GATC 3 cut(s) 119, 130, 189
DrdI GACNNNNNNGTC 1 cut(s) 67
DseDI GACNNNNNNGTC 1 cut(s) 67
Eco130I CCWWGG 2 cut(s) 14, 115
Eco47I GGWCC 2 cut(s) 10, 147
EcoNI CCTNNNNNAGG 1 cut(s) 18
EcoO109I RGGNCCY 1 cut(s) 10
EcoT14I CCWWGG 2 cut(s) 14, 115
ErhI CCWWGG 2 cut(s) 14, 115
FspBI CTAG 1 cut(s) 15
HaeIII GGCC 1 cut(s) 114
HapII CCGG 3 cut(s) 84, 111, 145
HgaI GACGC 1 cut(s) 57
Hin1I GRCGYC 1 cut(s) 68
HinfI GANTC 1 cut(s) 185
HpaII CCGG 3 cut(s) 84, 111, 145
HphI GGTGA 2 cut(s) 70, 98
Hpy188I TCNGA 1 cut(s) 97
Hpy99I CGWCG 1 cut(s) 73
HpyAV CCTTC 1 cut(s) 182
HpyCH4III ACNGT 1 cut(s) 64
HpyF3I CTNAG 2 cut(s) 77, 136
Hsp92I GRCGYC 1 cut(s) 68
Kzo9I GATC 3 cut(s) 119, 130, 189
LmnI GCTCC 3 cut(s) 38, 86, 113
LpnPI CCDG 3 cut(s) 97, 124, 158
LweI GCATC 1 cut(s) 63
MaeI CTAG 1 cut(s) 15
MaeIII GTNAC 2 cut(s) 58, 86
MalI GATC 3 cut(s) 121, 132, 191
MboI GATC 3 cut(s) 119, 130, 189
MluCI AATT 2 cut(s) 53, 166
MnlI CCTC 1 cut(s) 160
MspI CCGG 3 cut(s) 84, 111, 145
NdeII GATC 3 cut(s) 119, 130, 189
NlaIV GGNNCC 2 cut(s) 12, 143
NmuCI GTSAC 2 cut(s) 58, 86
PfeI GAWTC 1 cut(s) 185
Ple19I CGATCG 1 cut(s) 192
PpuMI RGGWCCY 1 cut(s) 10
Psp5II RGGWCCY 1 cut(s) 10
PspN4I GGNNCC 2 cut(s) 12, 143
PspPI GGNCC 2 cut(s) 10, 147
PspPPI RGGWCCY 1 cut(s) 10
PvuI CGATCG 1 cut(s) 192
Sau3AI GATC 3 cut(s) 119, 130, 189
Sau96I GGNCC 2 cut(s) 10, 147
SetI ASST 5 cut(s) 20, 43, 83, 104, 110
SfaNI GCATC 1 cut(s) 63
SfcI CTRYAG 1 cut(s) 103
SgeI CNNG 6 cut(s) 27, 61, 96, 123, 128, 157
SinI GGWCC 2 cut(s) 10, 147
Sse9I AATT 2 cut(s) 53, 166
SspMI CTAG 1 cut(s) 15
StyI CCWWGG 2 cut(s) 14, 115
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 4 cut(s) 50, 71, 122, 188
TasI AATT 2 cut(s) 53, 166
TfiI GAWTC 1 cut(s) 185
TscAI CASTG 1 cut(s) 69
TseFI GTSAC 2 cut(s) 58, 86
Tsp45I GTSAC 2 cut(s) 58, 86
TspRI CASTG 1 cut(s) 69
VpaK11BI GGWCC 2 cut(s) 10, 147
XagI CCTNNNNNAGG 1 cut(s) 18
XapI RAATTY 1 cut(s) 166
XmaJI CCTAGG 1 cut(s) 14
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.