Rh4CG252100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
50208563 .. 50209597
1035 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG252100.1

Sequence Viewer

Length: 171 bp
ATGATCTCAAGAGGCTCAAGAAGATCAGGAATCACCGTGGTCTTCGACACTACTAGGGCCTTCGTGTGCGTGGATAGCACATTAAGACCATTGGCCACAGGGGGAAGATTGTTGGAGTGTCCAAGAAGCGTTGAAGAACATATTTTGGCTGTTTGGGAGAATGTCATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.23

Weight (kDa)

7.86

Isoelectric Point (pI)

71.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 93
AgsI TTSAA 1 cut(s) 134
AoxI GGCC 2 cut(s) 57, 93
AspS9I GGNCC 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 25
BalI TGGCCA 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 34
BfaI CTAG 1 cut(s) 54
BmgT120I GGNCC 1 cut(s) 57
BpiI GAAGAC 1 cut(s) 34
BsaJI CCNNGG 1 cut(s) 36
BseDI CCNNGG 1 cut(s) 36
BshFI GGCC 2 cut(s) 59, 95
BsnI GGCC 2 cut(s) 59, 95
Bsp143I GATC 2 cut(s) 3, 23
BspANI GGCC 2 cut(s) 59, 95
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 2 cut(s) 3, 23
Bst4CI ACNGT 1 cut(s) 37
BstDSI CCRYGG 1 cut(s) 36
BstKTI GATC 2 cut(s) 6, 26
BstMBI GATC 2 cut(s) 3, 23
BstMWI GCNNNNNNNGC 1 cut(s) 75
BstV2I GAAGAC 1 cut(s) 34
BsuRI GGCC 2 cut(s) 59, 95
BtgI CCRYGG 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 57
CviAII CATG 1 cut(s) 166
CviJI RGCY 4 cut(s) 15, 59, 95, 149
CviKI_1 RGCY 4 cut(s) 15, 59, 95, 149
DpnI GATC 2 cut(s) 5, 25
DpnII GATC 2 cut(s) 3, 23
EaeI YGGCCR 1 cut(s) 93
EcoO109I RGGNCCY 1 cut(s) 57
FaeI CATG 1 cut(s) 169
FaiI YATR 2 cut(s) 141, 167
FatI CATG 1 cut(s) 165
FspBI CTAG 1 cut(s) 54
HaeIII GGCC 2 cut(s) 59, 95
Hin1II CATG 1 cut(s) 169
HinfI GANTC 1 cut(s) 30
HphI GGTGA 1 cut(s) 25
Hpy188III TCNNGA 3 cut(s) 9, 18, 27
HpyAV CCTTC 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 1 cut(s) 75
Hsp92II CATG 1 cut(s) 169
Kzo9I GATC 2 cut(s) 3, 23
LpnPI CCDG 2 cut(s) 12, 84
MaeI CTAG 1 cut(s) 54
MalI GATC 2 cut(s) 5, 25
MboI GATC 2 cut(s) 3, 23
MboII GAAGA 4 cut(s) 33, 34, 117, 146
MlsI TGGCCA 1 cut(s) 95
MluNI TGGCCA 1 cut(s) 95
MmeI TCCRAC 1 cut(s) 93
MnlI CCTC 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 95
MscI TGGCCA 1 cut(s) 95
MseI TTAA 1 cut(s) 83
Msp20I TGGCCA 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 75
NdeII GATC 2 cut(s) 3, 23
NlaIII CATG 1 cut(s) 169
PfeI GAWTC 1 cut(s) 30
PspPI GGNCC 1 cut(s) 57
SaqAI TTAA 1 cut(s) 83
Sau3AI GATC 2 cut(s) 3, 23
Sau96I GGNCC 1 cut(s) 57
SgeI CNNG 9 cut(s) 21, 30, 39, 49, 66, 76, 82, 111, 135
SmlI CTYRAG 2 cut(s) 7, 16
SmoI CTYRAG 2 cut(s) 7, 16
SspMI CTAG 1 cut(s) 54
TaaI ACNGT 1 cut(s) 37
TaqI TCGA 1 cut(s) 45
TfiI GAWTC 1 cut(s) 30
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.