Rmu_sc0009984.1_g000006

Ribosomal protein S13/S18

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009984.1
OG0002552
Physical Location & Seq
Reverse (-)
24695 .. 26089
1395 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009984.1_g000006.1.cds

Sequence Viewer

Length: 408 bp
atgaacggcggtggagaggggcttgtggctccggcgacgtctggagaggcgatggcaccgctcaactggaagtttctcaggtttttggagaacagaccgcctgcgaggaagttcaggaaggtactcttctcgattctttcctttcgttttcgggctggtgagctaactgctgccaaaattaataacctgatgttcattgtgggaaatccccgccaattcaatatccctgactggtttctcaacacaaagaaggattacaaggatggaatcaccgtggtcttcgacactactagggccttcgtgtgcgtggacagcacagcaagaccattggccacagggggaagatttttggagtgtccaagaagcgttgaagaacatattttggctgtttgggaggatgtcatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S13

Protein Analysis

135

Amino Acids

15.23

Weight (kDa)

9.38

Isoelectric Point (pI)

35.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 41
AccB1I GGYRCC 1 cut(s) 55
AccBSI CCGCTC 1 cut(s) 61
AciI CCGC 4 cut(s) 9, 59, 98, 211
AcoI YGGCCR 1 cut(s) 330
AcyI GRCGYC 1 cut(s) 38
AfaI GTAC 1 cut(s) 123
AgsI TTSAA 2 cut(s) 220, 371
AluBI AGCT 1 cut(s) 163
AluI AGCT 1 cut(s) 163
AoxI GGCC 2 cut(s) 294, 330
ApeKI GCWGC 1 cut(s) 170
AseI ATTAAT 1 cut(s) 180
AspS9I GGNCC 1 cut(s) 294
AsuHPI GGTGA 2 cut(s) 170, 262
BalI TGGCCA 1 cut(s) 332
BanI GGYRCC 1 cut(s) 55
BbsI GAAGAC 1 cut(s) 271
BbvI GCAGC 1 cut(s) 157
BccI CCATC 2 cut(s) 46, 257
BceAI ACGGC 1 cut(s) 22
BfaI CTAG 1 cut(s) 291
BisI GCNGC 1 cut(s) 171
BlsI GCNGC 1 cut(s) 172
BmgT120I GGNCC 1 cut(s) 294
BmiI GGNNCC 2 cut(s) 30, 57
BpiI GAAGAC 1 cut(s) 271
BpmI CTGGAG 1 cut(s) 63
BsaHI GRCGYC 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 273
Bse1I ACTGG 2 cut(s) 71, 236
BseDI CCNNGG 1 cut(s) 273
BseGI GGATG 2 cut(s) 268, 403
BseMII CTCAG 1 cut(s) 91
BseNI ACTGG 2 cut(s) 71, 236
BseXI GCAGC 1 cut(s) 157
BshFI GGCC 2 cut(s) 296, 332
BshNI GGYRCC 1 cut(s) 55
BsiSI CCGG 1 cut(s) 32
BsnI GGCC 2 cut(s) 296, 332
BspACI CCGC 4 cut(s) 9, 59, 98, 211
BspANI GGCC 2 cut(s) 296, 332
BspCNI CTCAG 1 cut(s) 90
BspLI GGNNCC 2 cut(s) 30, 57
BspT107I GGYRCC 1 cut(s) 55
BsrBI CCGCTC 1 cut(s) 61
BsrI ACTGG 2 cut(s) 71, 236
BssECI CCNNGG 1 cut(s) 273
BssNI GRCGYC 1 cut(s) 38
Bst4CI ACNGT 1 cut(s) 274
Bst6I CTCTTC 1 cut(s) 131
BstACI GRCGYC 1 cut(s) 38
BstC8I GCNNGC 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 77
BstDSI CCRYGG 1 cut(s) 273
BstF5I GGATG 2 cut(s) 268, 403
BstMWI GCNNNNNNNGC 1 cut(s) 312
BstV1I GCAGC 1 cut(s) 157
BstV2I GAAGAC 1 cut(s) 271
BsuRI GGCC 2 cut(s) 296, 332
BtgI CCRYGG 1 cut(s) 273
BtgZI GCGATG 1 cut(s) 65
BtsCI GGATG 2 cut(s) 268, 403
Cac8I GCNNGC 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 294
Csp6I GTAC 1 cut(s) 122
CviAII CATG 1 cut(s) 403
CviJI RGCY 7 cut(s) 22, 29, 155, 163, 296, 332, 386
CviKI_1 RGCY 7 cut(s) 22, 29, 155, 163, 296, 332, 386
CviQI GTAC 1 cut(s) 122
DdeI CTNAG 1 cut(s) 77
EaeI YGGCCR 1 cut(s) 330
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
EcoO109I RGGNCCY 1 cut(s) 294
FaeI CATG 1 cut(s) 406
FaiI YATR 2 cut(s) 378, 404
FalI AAGNNNNNCTT 2 cut(s) 110, 142
FatI CATG 1 cut(s) 402
FauI CCCGC 1 cut(s) 218
Fnu4HI GCNGC 1 cut(s) 171
FokI GGATG 1 cut(s) 275
Fsp4HI GCNGC 1 cut(s) 171
FspBI CTAG 1 cut(s) 291
GluI GCNGC 1 cut(s) 171
GsuI CTGGAG 1 cut(s) 63
HaeIII GGCC 2 cut(s) 296, 332
HapII CCGG 1 cut(s) 32
Hin1I GRCGYC 1 cut(s) 38
Hin1II CATG 1 cut(s) 406
HinfI GANTC 2 cut(s) 133, 267
HpaII CCGG 1 cut(s) 32
HphI GGTGA 2 cut(s) 170, 262
Hpy166II GTNNAC 1 cut(s) 310
Hpy188III TCNNGA 3 cut(s) 42, 115, 130
Hpy8I GTNNAC 1 cut(s) 310
Hpy99I CGWCG 1 cut(s) 40
HpyAV CCTTC 3 cut(s) 112, 244, 307
HpyCH4III ACNGT 1 cut(s) 274
HpyCH4IV ACGT 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 1 cut(s) 312
HpyF3I CTNAG 1 cut(s) 77
HpySE526I ACGT 1 cut(s) 38
Hsp92I GRCGYC 1 cut(s) 38
Hsp92II CATG 1 cut(s) 406
LmnI GCTCC 1 cut(s) 34
Lsp1109I GCAGC 1 cut(s) 157
MaeI CTAG 1 cut(s) 291
MaeII ACGT 1 cut(s) 38
MbiI CCGCTC 1 cut(s) 61
MboII GAAGA 4 cut(s) 118, 271, 354, 383
MlsI TGGCCA 1 cut(s) 332
MluCI AATT 2 cut(s) 177, 215
MluNI TGGCCA 1 cut(s) 332
MnlI CCTC 4 cut(s) 10, 40, 99, 388
Mox20I TGGCCA 1 cut(s) 332
MscI TGGCCA 1 cut(s) 332
MseI TTAA 1 cut(s) 180
Msp20I TGGCCA 1 cut(s) 332
MspI CCGG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 312
NlaIII CATG 1 cut(s) 406
NlaIV GGNNCC 2 cut(s) 30, 57
PfeI GAWTC 2 cut(s) 133, 267
PkrI GCNGC 1 cut(s) 172
PshBI ATTAAT 1 cut(s) 180
PspN4I GGNNCC 2 cut(s) 30, 57
PspPI GGNCC 1 cut(s) 294
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
SaqAI TTAA 1 cut(s) 180
SatI GCNGC 1 cut(s) 171
Sau96I GGNCC 1 cut(s) 294
SetI ASST 5 cut(s) 41, 83, 123, 165, 189
Sse9I AATT 2 cut(s) 177, 215
SsiI CCGC 4 cut(s) 9, 59, 98, 211
SspMI CTAG 1 cut(s) 291
TaaI ACNGT 1 cut(s) 274
TaiI ACGT 1 cut(s) 41
TaqI TCGA 2 cut(s) 131, 282
TasI AATT 2 cut(s) 177, 215
TfiI GAWTC 2 cut(s) 133, 267
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TseI GCWGC 1 cut(s) 170
TspDTI ATGAA 2 cut(s) 17, 184
VspI ATTAAT 1 cut(s) 180
XspI CTAG 1 cut(s) 291
ZraI GACGTC 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.