Rmu_sc0000706.1_g000005

Belongs to the universal ribosomal protein uS13 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000706.1
Physical Location & Seq
Forward (+)
11811 .. 13624
1814 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000706.1_g000005.1.cds

Sequence Viewer

Length: 414 bp
atggggtgttctgtaacaggcgttaagcctgcattggggattctcctttacagaggggctcgtggctccggcgacgtctggagaggcgatggagcagctcgactagaagttttctcaggtttttggagaacagaccgcctgcgaggaagttcaggaagggctggtgagctaactgctgccaaaattaataacctgatgttcattgtgggaaatccccgccagttcaagatccctgactggtttctcaacgcaaagaaggattacaaggatggaatcaccgtggtcttcgacactattagggccttcgagtgcgtggacagcacagcaagaccatttgccacagggggaagattgttggagtgtccaagaagcgttgaagaacatattttggctgtttgggaggatgtcatgtag

Protein Analysis

137

Amino Acids

15.13

Weight (kDa)

8.93

Isoelectric Point (pI)

22.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 78
AciI CCGC 2 cut(s) 136, 217
AclWI GGATC 1 cut(s) 223
AcyI GRCGYC 1 cut(s) 75
AfiI CCNNNNNNNGG 1 cut(s) 35
AgsI TTSAA 2 cut(s) 226, 377
AluBI AGCT 2 cut(s) 98, 169
AluI AGCT 2 cut(s) 98, 169
AlwI GGATC 1 cut(s) 223
AoxI GGCC 1 cut(s) 300
ApeKI GCWGC 2 cut(s) 95, 176
AseI ATTAAT 1 cut(s) 186
AspS9I GGNCC 1 cut(s) 300
AsuHPI GGTGA 2 cut(s) 176, 268
BanII GRGCYC 1 cut(s) 61
BauI CACGAG 1 cut(s) 60
BbsI GAAGAC 1 cut(s) 277
BbvI GCAGC 2 cut(s) 107, 163
BccI CCATC 2 cut(s) 83, 263
BfaI CTAG 1 cut(s) 104
BisI GCNGC 2 cut(s) 96, 177
BlsI GCNGC 2 cut(s) 97, 178
BmgT120I GGNCC 1 cut(s) 300
BmiI GGNNCC 1 cut(s) 67
BpiI GAAGAC 1 cut(s) 277
BpmI CTGGAG 1 cut(s) 100
BsaHI GRCGYC 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 279
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse1I ACTGG 2 cut(s) 220, 242
BseDI CCNNGG 1 cut(s) 279
BseGI GGATG 2 cut(s) 274, 409
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 129
BseNI ACTGG 2 cut(s) 220, 242
BseXI GCAGC 2 cut(s) 107, 163
BshFI GGCC 1 cut(s) 302
BsiSI CCGG 1 cut(s) 69
BslI CCNNNNNNNGG 1 cut(s) 35
BsnI GGCC 1 cut(s) 302
Bsp1286I GDGCHC 1 cut(s) 61
Bsp143I GATC 1 cut(s) 228
BspACI CCGC 2 cut(s) 136, 217
BspANI GGCC 1 cut(s) 302
BspCNI CTCAG 1 cut(s) 128
BspLI GGNNCC 1 cut(s) 67
BspPI GGATC 1 cut(s) 223
BsrI ACTGG 2 cut(s) 220, 242
BssECI CCNNGG 1 cut(s) 279
BssMI GATC 1 cut(s) 228
BssNI GRCGYC 1 cut(s) 75
BssSI CACGAG 1 cut(s) 60
Bst2BI CACGAG 1 cut(s) 60
Bst4CI ACNGT 1 cut(s) 280
BstACI GRCGYC 1 cut(s) 75
BstC8I GCNNGC 2 cut(s) 30, 140
BstDEI CTNAG 1 cut(s) 115
BstDSI CCRYGG 1 cut(s) 279
BstF5I GGATG 2 cut(s) 274, 409
BstKTI GATC 1 cut(s) 231
BstMBI GATC 1 cut(s) 228
BstMWI GCNNNNNNNGC 1 cut(s) 318
BstV1I GCAGC 2 cut(s) 107, 163
BstV2I GAAGAC 1 cut(s) 277
BstX2I RGATCY 1 cut(s) 228
BstYI RGATCY 1 cut(s) 228
BsuRI GGCC 1 cut(s) 302
BtgI CCRYGG 1 cut(s) 279
BtgZI GCGATG 1 cut(s) 102
BtsCI GGATG 2 cut(s) 274, 409
Cac8I GCNNGC 2 cut(s) 30, 140
Cfr13I GGNCC 1 cut(s) 300
CviAII CATG 1 cut(s) 409
CviJI RGCY 8 cut(s) 28, 59, 66, 98, 161, 169, 302, 392
CviKI_1 RGCY 8 cut(s) 28, 59, 66, 98, 161, 169, 302, 392
DdeI CTNAG 1 cut(s) 115
DpnI GATC 1 cut(s) 230
DpnII GATC 1 cut(s) 228
Eco24I GRGCYC 1 cut(s) 61
EcoO109I RGGNCCY 1 cut(s) 300
EcoT38I GRGCYC 1 cut(s) 61
FaeI CATG 1 cut(s) 412
FaiI YATR 2 cut(s) 384, 410
FatI CATG 1 cut(s) 408
FauI CCCGC 1 cut(s) 224
Fnu4HI GCNGC 2 cut(s) 96, 177
FokI GGATG 1 cut(s) 281
FriOI GRGCYC 1 cut(s) 61
Fsp4HI GCNGC 2 cut(s) 96, 177
FspBI CTAG 1 cut(s) 104
GluI GCNGC 2 cut(s) 96, 177
GsuI CTGGAG 1 cut(s) 100
HaeIII GGCC 1 cut(s) 302
HapII CCGG 1 cut(s) 69
Hin1I GRCGYC 1 cut(s) 75
Hin1II CATG 1 cut(s) 412
HinfI GANTC 2 cut(s) 40, 273
HpaII CCGG 1 cut(s) 69
HphI GGTGA 2 cut(s) 176, 268
Hpy166II GTNNAC 1 cut(s) 316
Hpy188III TCNNGA 3 cut(s) 79, 153, 226
Hpy8I GTNNAC 1 cut(s) 316
Hpy99I CGWCG 1 cut(s) 77
HpyAV CCTTC 3 cut(s) 150, 250, 313
HpyCH4III ACNGT 1 cut(s) 280
HpyCH4IV ACGT 1 cut(s) 75
HpyCH4V TGCA 1 cut(s) 32
HpyF10VI GCNNNNNNNGC 1 cut(s) 318
HpyF3I CTNAG 1 cut(s) 115
HpySE526I ACGT 1 cut(s) 75
Hsp92I GRCGYC 1 cut(s) 75
Hsp92II CATG 1 cut(s) 412
Kzo9I GATC 1 cut(s) 228
LmnI GCTCC 2 cut(s) 71, 92
Lsp1109I GCAGC 2 cut(s) 107, 163
MaeI CTAG 1 cut(s) 104
MaeII ACGT 1 cut(s) 75
MaeIII GTNAC 1 cut(s) 13
MalI GATC 1 cut(s) 230
MboI GATC 1 cut(s) 228
MboII GAAGA 3 cut(s) 277, 360, 389
MflI RGATCY 1 cut(s) 228
MhlI GDGCHC 1 cut(s) 61
MluCI AATT 1 cut(s) 183
MmeI TCCRAC 1 cut(s) 336
MnlI CCTC 4 cut(s) 47, 77, 137, 394
MseI TTAA 2 cut(s) 24, 186
MspI CCGG 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 318
NdeII GATC 1 cut(s) 228
NlaIII CATG 1 cut(s) 412
NlaIV GGNNCC 1 cut(s) 67
PfeI GAWTC 2 cut(s) 40, 273
PkrI GCNGC 2 cut(s) 97, 178
PshBI ATTAAT 1 cut(s) 186
PspN4I GGNNCC 1 cut(s) 67
PspPI GGNCC 1 cut(s) 300
PsuI RGATCY 1 cut(s) 228
SaqAI TTAA 2 cut(s) 24, 186
SatI GCNGC 2 cut(s) 96, 177
Sau3AI GATC 1 cut(s) 228
Sau96I GGNCC 1 cut(s) 300
SduI GDGCHC 1 cut(s) 61
SetI ASST 5 cut(s) 78, 100, 121, 171, 195
Sse9I AATT 1 cut(s) 183
SsiI CCGC 2 cut(s) 136, 217
SspMI CTAG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 280
TaiI ACGT 1 cut(s) 78
TaqI TCGA 3 cut(s) 100, 288, 306
TasI AATT 1 cut(s) 183
TfiI GAWTC 2 cut(s) 40, 273
Tru1I TTAA 2 cut(s) 24, 186
Tru9I TTAA 2 cut(s) 24, 186
TseI GCWGC 2 cut(s) 95, 176
TspDTI ATGAA 1 cut(s) 190
VspI ATTAAT 1 cut(s) 186
XspI CTAG 1 cut(s) 104
ZraI GACGTC 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.