RchiOBHm_Chr5g0034931

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
28865521 .. 28866453
933 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31388

Sequence Viewer

Length: 339 bp
ATGAAGCTCAGGGATGATCTCAAGAGGCTCAAGAAGATCAGTTTGATATTGTTGTTGGTATTAGCAATTGTTTTGCTGAATGATTCTGGCAAGTGTTTGGTCTTTAAACAAATTTTTTTAAAATTGACCTCCTGCTTTCTTTTCTCTTATCATGTTGGTCATCTGTGTTCTGAACATTGTTTTTTACATGCTACTGAGAACACAGATTCTATGACTACATGCTACATGCTACATGCTTTGAACATTGAATGTTTGAGTCAAGTCTTGCTGGTTTCTCATCATTTTTTACTTTATTTTGTGGTATCTACATGGAATCACCGTGGTCTTCGACACTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.07

Weight (kDa)

8.81

Isoelectric Point (pI)

45.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 111
AgsI TTSAA 2 cut(s) 241, 248
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
ApoI RAATTY 1 cut(s) 111
AsuHPI GGTGA 1 cut(s) 308
BbsI GAAGAC 1 cut(s) 317
BfaI CTAG 1 cut(s) 337
BpiI GAAGAC 1 cut(s) 317
Bpu10I CCTNAGC 1 cut(s) 8
BpuEI CTTGAG 2 cut(s) 5, 14
BsaJI CCNNGG 1 cut(s) 319
BseDI CCNNGG 1 cut(s) 319
BseGI GGATG 1 cut(s) 19
BseMII CTCAG 2 cut(s) 22, 186
Bsp143I GATC 2 cut(s) 16, 36
BspCNI CTCAG 2 cut(s) 21, 187
BssECI CCNNGG 1 cut(s) 319
BssMI GATC 2 cut(s) 16, 36
Bst4CI ACNGT 1 cut(s) 320
BstDEI CTNAG 2 cut(s) 8, 195
BstDSI CCRYGG 1 cut(s) 319
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 2 cut(s) 19, 39
BstMBI GATC 2 cut(s) 16, 36
BstNSI RCATGY 4 cut(s) 191, 222, 229, 236
BstV2I GAAGAC 1 cut(s) 317
BtgI CCRYGG 1 cut(s) 319
BtsCI GGATG 1 cut(s) 19
CviAII CATG 6 cut(s) 152, 188, 219, 226, 233, 309
CviJI RGCY 2 cut(s) 7, 28
CviKI_1 RGCY 2 cut(s) 7, 28
DdeI CTNAG 2 cut(s) 8, 195
DpnI GATC 2 cut(s) 18, 38
DpnII GATC 2 cut(s) 16, 36
DraI TTTAAA 2 cut(s) 106, 120
FaeI CATG 6 cut(s) 155, 191, 222, 229, 236, 312
FaiI YATR 7 cut(s) 153, 189, 212, 220, 227, 234, 310
FatI CATG 6 cut(s) 151, 187, 218, 225, 232, 308
FokI GGATG 1 cut(s) 26
FspBI CTAG 1 cut(s) 337
Hin1II CATG 6 cut(s) 155, 191, 222, 229, 236, 312
HinfI GANTC 4 cut(s) 83, 206, 256, 313
HphI GGTGA 1 cut(s) 308
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 22, 31
HpyCH4III ACNGT 1 cut(s) 320
HpyF3I CTNAG 2 cut(s) 8, 195
Hsp92II CATG 6 cut(s) 155, 191, 222, 229, 236, 312
Kzo9I GATC 2 cut(s) 16, 36
LpnPI CCDG 3 cut(s) 72, 145, 254
MaeI CTAG 1 cut(s) 337
MalI GATC 2 cut(s) 18, 38
MboI GATC 2 cut(s) 16, 36
MboII GAAGA 2 cut(s) 46, 317
MfeI CAATTG 1 cut(s) 66
MluCI AATT 3 cut(s) 66, 111, 122
MlyI GAGTC 1 cut(s) 265
MnlI CCTC 2 cut(s) 18, 139
MseI TTAA 2 cut(s) 105, 119
MunI CAATTG 1 cut(s) 66
NdeII GATC 2 cut(s) 16, 36
NlaIII CATG 6 cut(s) 155, 191, 222, 229, 236, 312
NspI RCATGY 4 cut(s) 191, 222, 229, 236
PfeI GAWTC 3 cut(s) 83, 206, 313
PleI GAGTC 1 cut(s) 264
PpsI GAGTC 1 cut(s) 264
SaqAI TTAA 2 cut(s) 105, 119
Sau3AI GATC 2 cut(s) 16, 36
SchI GAGTC 1 cut(s) 265
SetI ASST 2 cut(s) 9, 131
SmlI CTYRAG 2 cut(s) 20, 29
SmoI CTYRAG 2 cut(s) 20, 29
Sse9I AATT 3 cut(s) 66, 111, 122
SspMI CTAG 1 cut(s) 337
TaaI ACNGT 1 cut(s) 320
TaqI TCGA 1 cut(s) 328
TasI AATT 3 cut(s) 66, 111, 122
TfiI GAWTC 3 cut(s) 83, 206, 313
Tru1I TTAA 2 cut(s) 105, 119
Tru9I TTAA 2 cut(s) 105, 119
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 111
XceI RCATGY 4 cut(s) 191, 222, 229, 236
XspI CTAG 1 cut(s) 337
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.