RchiOBHm_Chr2g0152691

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
70120444 .. 70121406
963 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52183

Sequence Viewer

Length: 231 bp
ATGCTTCGGATAAGCGAGAACATATTTACACGAGGGAGTAATTGGAGAAGGCACAAACTGCTGATCCTCTCTGGAATGCCTCCCAATGTGAGATGGTTCATTACGGGAAGATGCATGGTTTTATGCAGTAAGGAACTATTCTCTGTCAGGAGAGCAAGTTTAAGTTATTGTTTCATCTGCAGGATGTATTGGGCAAAAAAGATCCTTGAGTGGACAAGAGGACAAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

9.16

Weight (kDa)

10.9

Isoelectric Point (pI)

55.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 58, 196
AlwI GGATC 2 cut(s) 58, 196
BauI CACGAG 1 cut(s) 30
BccI CCATC 1 cut(s) 87
BfmI CTRYAG 1 cut(s) 178
BmsI GCATC 1 cut(s) 101
BpuEI CTTGAG 1 cut(s) 227
BsaXI ACNNNNNCTCC 2 cut(s) 142, 172
BseGI GGATG 1 cut(s) 189
BsmI GAATGC 1 cut(s) 81
Bsp143I GATC 2 cut(s) 63, 201
BspMAI CTGCAG 1 cut(s) 182
BspPI GGATC 2 cut(s) 58, 196
BssMI GATC 2 cut(s) 63, 201
BssSI CACGAG 1 cut(s) 30
Bst2BI CACGAG 1 cut(s) 30
BstAPI GCANNNNNTGC 1 cut(s) 58
BstF5I GGATG 1 cut(s) 189
BstKTI GATC 2 cut(s) 66, 204
BstMBI GATC 2 cut(s) 63, 201
BstMWI GCNNNNNNNGC 1 cut(s) 58
BstSFI CTRYAG 1 cut(s) 178
BstX2I RGATCY 1 cut(s) 201
BstYI RGATCY 1 cut(s) 201
BtsCI GGATG 1 cut(s) 189
CviAII CATG 1 cut(s) 115
DpnI GATC 2 cut(s) 65, 203
DpnII GATC 2 cut(s) 63, 201
EcoT22I ATGCAT 1 cut(s) 116
FaeI CATG 1 cut(s) 118
FaiI YATR 3 cut(s) 23, 116, 124
FatI CATG 1 cut(s) 114
FokI GGATG 1 cut(s) 196
Hin1II CATG 1 cut(s) 118
Hpy166II GTNNAC 1 cut(s) 213
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 2 cut(s) 72, 148
Hpy8I GTNNAC 1 cut(s) 213
HpyAV CCTTC 1 cut(s) 42
HpyCH4V TGCA 3 cut(s) 114, 126, 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
Hsp92II CATG 1 cut(s) 118
Kzo9I GATC 2 cut(s) 63, 201
LpnPI CCDG 3 cut(s) 57, 133, 166
LweI GCATC 1 cut(s) 101
MalI GATC 2 cut(s) 65, 203
MboI GATC 2 cut(s) 63, 201
MboII GAAGA 1 cut(s) 120
MflI RGATCY 1 cut(s) 201
MluCI AATT 1 cut(s) 40
MnlI CCTC 4 cut(s) 26, 77, 90, 212
Mph1103I ATGCAT 1 cut(s) 116
MseI TTAA 1 cut(s) 161
Mva1269I GAATGC 1 cut(s) 81
MwoI GCNNNNNNNGC 1 cut(s) 58
NdeII GATC 2 cut(s) 63, 201
NlaIII CATG 1 cut(s) 118
NsiI ATGCAT 1 cut(s) 116
PctI GAATGC 1 cut(s) 81
PstI CTGCAG 1 cut(s) 182
PsuI RGATCY 1 cut(s) 201
SaqAI TTAA 1 cut(s) 161
Sau3AI GATC 2 cut(s) 63, 201
SfaNI GCATC 1 cut(s) 101
SfcI CTRYAG 1 cut(s) 178
SmlI CTYRAG 1 cut(s) 206
SmoI CTYRAG 1 cut(s) 206
Sse9I AATT 1 cut(s) 40
TasI AATT 1 cut(s) 40
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TspDTI ATGAA 2 cut(s) 88, 163
Zsp2I ATGCAT 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.