Rmu_sc0002058.1_g000010

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002058.1
Physical Location & Seq
Forward (+)
29354 .. 29900
547 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002058.1_g000010.1.cds

Sequence Viewer

Length: 333 bp
atgaagtgtgtcaataacgaattcggtgtaggtattgtgacggggacgaccagttgttatgttcgcaaaggcagtagcttaaagagcaatcttgaattcgtttgtctcagccgtttcggaacgatgacgactagaagggtattttggtgcagtggcggtggtggtggcgttgttgtggaggtcggtggagaaagaggcggtgttgatttggtcgtggacgaaggagaacgatcgggggatggagggattgggctaggaagagaagcaagagagagtgggctggaggatgaagaagggggagccgatgagaaggtatgggtttgtggagggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

11.41

Weight (kDa)

4.74

Isoelectric Point (pI)

26.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 156, 198
AcsI RAATTY 2 cut(s) 20, 95
AgsI TTSAA 1 cut(s) 95
AjuI GAANNNNNNNTTGG 2 cut(s) 127, 159
AluBI AGCT 1 cut(s) 78
AluI AGCT 1 cut(s) 78
Alw26I GTCTC 1 cut(s) 110
ApoI RAATTY 2 cut(s) 20, 95
BccI CCATC 1 cut(s) 233
BceAI ACGGC 1 cut(s) 96
BcoDI GTCTC 1 cut(s) 110
BfaI CTAG 2 cut(s) 132, 254
BmiI GGNNCC 1 cut(s) 301
BpmI CTGGAG 1 cut(s) 302
Bse1I ACTGG 1 cut(s) 51
BseGI GGATG 2 cut(s) 244, 292
BseMII CTCAG 1 cut(s) 121
BseNI ACTGG 1 cut(s) 51
BsgI GTGCAG 1 cut(s) 169
Bsh1285I CGRYCG 1 cut(s) 233
BsiEI CGRYCG 1 cut(s) 233
BslFI GGGAC 1 cut(s) 58
BsmAI GTCTC 1 cut(s) 110
BsmFI GGGAC 1 cut(s) 58
Bsp143I GATC 1 cut(s) 230
BspACI CCGC 2 cut(s) 156, 198
BspCNI CTCAG 1 cut(s) 120
BspLI GGNNCC 1 cut(s) 301
BsrI ACTGG 1 cut(s) 51
BssMI GATC 1 cut(s) 230
Bst6I CTCTTC 1 cut(s) 253
BstDEI CTNAG 1 cut(s) 107
BstF5I GGATG 2 cut(s) 244, 292
BstKTI GATC 1 cut(s) 233
BstMAI GTCTC 1 cut(s) 110
BstMBI GATC 1 cut(s) 230
BstMCI CGRYCG 1 cut(s) 233
BstMWI GCNNNNNNNGC 1 cut(s) 84
BtsCI GGATG 2 cut(s) 244, 292
BtsI GCAGTG 1 cut(s) 157
BtsIMutI CAGTG 1 cut(s) 157
CviJI RGCY 5 cut(s) 78, 111, 253, 280, 302
CviKI_1 RGCY 5 cut(s) 78, 111, 253, 280, 302
DdeI CTNAG 1 cut(s) 107
DpnI GATC 1 cut(s) 232
DpnII GATC 1 cut(s) 230
Eam1104I CTCTTC 1 cut(s) 253
EarI CTCTTC 1 cut(s) 253
EcoRI GAATTC 2 cut(s) 20, 95
FaiI YATR 2 cut(s) 60, 316
FaqI GGGAC 1 cut(s) 58
FokI GGATG 2 cut(s) 251, 299
FspBI CTAG 2 cut(s) 132, 254
GsuI CTGGAG 1 cut(s) 302
Hpy166II GTNNAC 1 cut(s) 217
Hpy188I TCNGA 1 cut(s) 119
Hpy188III TCNNGA 1 cut(s) 92
Hpy8I GTNNAC 1 cut(s) 217
HpyAV CCTTC 4 cut(s) 129, 215, 287, 304
HpyCH4V TGCA 1 cut(s) 150
HpyF10VI GCNNNNNNNGC 1 cut(s) 84
HpyF3I CTNAG 1 cut(s) 107
Kzo9I GATC 1 cut(s) 230
LmnI GCTCC 1 cut(s) 299
LpnPI CCDG 2 cut(s) 64, 266
MaeI CTAG 2 cut(s) 132, 254
MaeIII GTNAC 1 cut(s) 37
MalI GATC 1 cut(s) 232
MboI GATC 1 cut(s) 230
MboII GAAGA 2 cut(s) 270, 302
MluCI AATT 2 cut(s) 20, 95
MnlI CCTC 5 cut(s) 172, 188, 236, 277, 320
MseI TTAA 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 84
NdeII GATC 1 cut(s) 230
NlaIV GGNNCC 1 cut(s) 301
NmuCI GTSAC 1 cut(s) 37
Ple19I CGATCG 1 cut(s) 233
PspN4I GGNNCC 1 cut(s) 301
PvuI CGATCG 1 cut(s) 233
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 1 cut(s) 230
SetI ASST 4 cut(s) 34, 80, 183, 315
SgeI CNNG 9 cut(s) 54, 63, 104, 144, 226, 246, 266, 279, 293
Sse9I AATT 2 cut(s) 20, 95
SsiI CCGC 2 cut(s) 156, 198
SspMI CTAG 2 cut(s) 132, 254
TasI AATT 2 cut(s) 20, 95
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TscAI CASTG 1 cut(s) 157
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspDTI ATGAA 2 cut(s) 17, 303
TspRI CASTG 1 cut(s) 157
XapI RAATTY 2 cut(s) 20, 95
XspI CTAG 2 cut(s) 132, 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.