Rh2DG294900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
34692762 .. 34692923
162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG294900.1

Sequence Viewer

Length: 162 bp
ATGAAGGTCGGCGAAGAAAGAGGCGGTGTTGATTCGGTCACGAATGGAGGAGAAGGATCTAGGGATAGAGGGATTGGGCTCGGAAGGGGAGAGTTAGGAGAGAGGGGGCTGGAAGATGAAGAAGGTGGAGCCAATGAGAATGCCAACGAGGATGAAGATGAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.61

Weight (kDa)

4.15

Isoelectric Point (pI)

17.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 24
AclWI GGATC 1 cut(s) 64
AlwI GGATC 1 cut(s) 64
BanII GRGCYC 1 cut(s) 81
BfaI CTAG 1 cut(s) 60
BmiI GGNNCC 1 cut(s) 130
BseGI GGATG 1 cut(s) 157
BseRI GAGGAG 1 cut(s) 63
BsmI GAATGC 1 cut(s) 145
Bsp1286I GDGCHC 1 cut(s) 81
Bsp143I GATC 1 cut(s) 56
BspACI CCGC 1 cut(s) 24
BspLI GGNNCC 1 cut(s) 130
BspPI GGATC 1 cut(s) 64
BssMI GATC 1 cut(s) 56
BstF5I GGATG 1 cut(s) 157
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BtsCI GGATG 1 cut(s) 157
CviJI RGCY 3 cut(s) 79, 109, 131
CviKI_1 RGCY 3 cut(s) 79, 109, 131
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
Eco24I GRGCYC 1 cut(s) 81
EcoT38I GRGCYC 1 cut(s) 81
FriOI GRGCYC 1 cut(s) 81
FspBI CTAG 1 cut(s) 60
HinfI GANTC 1 cut(s) 32
Hpy188I TCNGA 1 cut(s) 83
Hpy188III TCNNGA 1 cut(s) 40
HpyAV CCTTC 3 cut(s) 47, 78, 116
Kzo9I GATC 1 cut(s) 56
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 1 cut(s) 95
MaeI CTAG 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 37
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MboII GAAGA 3 cut(s) 26, 125, 131
MflI RGATCY 1 cut(s) 56
MhlI GDGCHC 1 cut(s) 81
MnlI CCTC 5 cut(s) 14, 41, 62, 96, 142
Mva1269I GAATGC 1 cut(s) 145
NdeII GATC 1 cut(s) 56
NlaIV GGNNCC 1 cut(s) 130
NmuCI GTSAC 1 cut(s) 37
PctI GAATGC 1 cut(s) 145
PfeI GAWTC 1 cut(s) 32
PspN4I GGNNCC 1 cut(s) 130
PsuI RGATCY 1 cut(s) 56
Sau3AI GATC 1 cut(s) 56
SduI GDGCHC 1 cut(s) 81
SetI ASST 2 cut(s) 9, 127
SgeI CNNG 4 cut(s) 52, 72, 92, 122
SsiI CCGC 1 cut(s) 24
SspMI CTAG 1 cut(s) 60
TaqII GACCGA 1 cut(s) 25
TfiI GAWTC 1 cut(s) 32
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspDTI ATGAA 2 cut(s) 17, 132
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.