RchiOBHm_Chr5g0034131

Armadillo/beta-catenin-like repeats

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0003482
Physical Location & Seq
Forward (+)
28058782 .. 28059764
983 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31316

Sequence Viewer

Length: 273 bp
ATGATTGGCACGAGCCCAGCCAACCGTACACTACTCGCCATCTCTCCCTCTCCTCAAGTCTCGCCGCCTCTCCGCCCAAACCTCCACCCTCAGATTCGCTCCGACACGTGTCTCCTCAAGCTTTCCTACAGCACCAAGCTTCTGATGCAGAGCGACCTGGACAAGCTCGCCGCTAAGTTATATTTCCACGCCGGAAGCTTCTCAGAGATCTACAAATCAAGCTTCCTATCTGTTTCTTTAAAATTTTCTGGGTATAAAAATCAAAGCTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Arm

Protein Analysis

90

Amino Acids

9.98

Weight (kDa)

9.78

Isoelectric Point (pI)

54.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7032 PF23005 35 - 74 4.8e-08 Domain of unknown function (DUF7032)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 65, 73, 171
AcsI RAATTY 1 cut(s) 242
AcvI CACGTG 1 cut(s) 108
AfaI GTAC 1 cut(s) 28
AflIII ACRYGT 2 cut(s) 105, 107
AjnI CCWGG 1 cut(s) 156
AluBI AGCT 6 cut(s) 121, 139, 166, 198, 222, 267
AluI AGCT 6 cut(s) 121, 139, 166, 198, 222, 267
Alw26I GTCTC 2 cut(s) 64, 116
ApoI RAATTY 1 cut(s) 242
BanII GRGCYC 1 cut(s) 17
BauI CACGAG 1 cut(s) 10
BbrPI CACGTG 1 cut(s) 108
BccI CCATC 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 158
BcoDI GTCTC 2 cut(s) 64, 116
BfmI CTRYAG 1 cut(s) 127
BglII AGATCT 1 cut(s) 207
BisI GCNGC 2 cut(s) 65, 171
BlsI GCNGC 2 cut(s) 66, 172
Bme1390I CCNGG 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 158
BmsI GCATC 1 cut(s) 135
BoxI GACNNNNGTC 1 cut(s) 108
BpuEI CTTGAG 2 cut(s) 39, 101
BsaAI YACGTR 1 cut(s) 108
BseBI CCWGG 1 cut(s) 158
BseMII CTCAG 2 cut(s) 104, 216
BseRI GAGGAG 2 cut(s) 42, 104
BseYI CCCAGC 1 cut(s) 16
BsiSI CCGG 1 cut(s) 192
BsmAI GTCTC 2 cut(s) 64, 116
Bsp1286I GDGCHC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 207
BspACI CCGC 3 cut(s) 65, 73, 171
BspCNI CTCAG 2 cut(s) 103, 215
BssMI GATC 1 cut(s) 207
BssSI CACGAG 1 cut(s) 10
Bst2BI CACGAG 1 cut(s) 10
Bst2UI CCWGG 1 cut(s) 158
Bst4CI ACNGT 1 cut(s) 26
BstBAI YACGTR 1 cut(s) 108
BstC8I GCNNGC 1 cut(s) 168
BstDEI CTNAG 3 cut(s) 90, 174, 202
BstKTI GATC 1 cut(s) 210
BstMAI GTCTC 2 cut(s) 64, 116
BstMBI GATC 1 cut(s) 207
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 158
BstPAI GACNNNNGTC 1 cut(s) 108
BstSCI CCNGG 1 cut(s) 156
BstSFI CTRYAG 1 cut(s) 127
BstX2I RGATCY 1 cut(s) 207
BstYI RGATCY 1 cut(s) 207
Cac8I GCNNGC 1 cut(s) 168
Csp6I GTAC 1 cut(s) 27
CviJI RGCY 8 cut(s) 15, 20, 121, 139, 166, 198, 222, 267
CviKI_1 RGCY 8 cut(s) 15, 20, 121, 139, 166, 198, 222, 267
CviQI GTAC 1 cut(s) 27
DdeI CTNAG 3 cut(s) 90, 174, 202
DpnI GATC 1 cut(s) 209
DpnII GATC 1 cut(s) 207
DraI TTTAAA 1 cut(s) 240
EciI GGCGGA 1 cut(s) 62
Eco24I GRGCYC 1 cut(s) 17
Eco72I CACGTG 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 156
EcoT38I GRGCYC 1 cut(s) 17
FaiI YATR 2 cut(s) 181, 255
Fnu4HI GCNGC 2 cut(s) 65, 171
FriOI GRGCYC 1 cut(s) 17
Fsp4HI GCNGC 2 cut(s) 65, 171
GluI GCNGC 2 cut(s) 65, 171
GsaI CCCAGC 1 cut(s) 20
HapII CCGG 1 cut(s) 192
HindIII AAGCTT 5 cut(s) 119, 137, 196, 220, 265
HinfI GANTC 1 cut(s) 94
HpaII CCGG 1 cut(s) 192
Hpy166II GTNNAC 1 cut(s) 29
Hpy188I TCNGA 4 cut(s) 93, 103, 144, 205
Hpy8I GTNNAC 1 cut(s) 29
HpyCH4III ACNGT 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 148
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 3 cut(s) 90, 174, 202
HpySE526I ACGT 1 cut(s) 107
Kzo9I GATC 1 cut(s) 207
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 5 cut(s) 30, 143, 170, 205, 234
LweI GCATC 1 cut(s) 135
MaeII ACGT 1 cut(s) 107
MalI GATC 1 cut(s) 209
MboI GATC 1 cut(s) 207
MflI RGATCY 1 cut(s) 207
MhlI GDGCHC 1 cut(s) 17
MluCI AATT 1 cut(s) 242
MmeI TCCRAC 1 cut(s) 126
MnlI CCTC 6 cut(s) 58, 63, 78, 92, 99, 125
MseI TTAA 1 cut(s) 239
MspI CCGG 1 cut(s) 192
MspR9I CCNGG 1 cut(s) 158
MvaI CCWGG 1 cut(s) 158
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 1 cut(s) 207
PfeI GAWTC 1 cut(s) 94
PkrI GCNGC 2 cut(s) 66, 172
PmaCI CACGTG 1 cut(s) 108
PmlI CACGTG 1 cut(s) 108
Ppu21I YACGTR 1 cut(s) 108
PshAI GACNNNNGTC 1 cut(s) 108
Psp6I CCWGG 1 cut(s) 156
PspCI CACGTG 1 cut(s) 108
PspFI CCCAGC 1 cut(s) 16
PspGI CCWGG 1 cut(s) 156
PsuI RGATCY 1 cut(s) 207
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
SaqAI TTAA 1 cut(s) 239
SatI GCNGC 2 cut(s) 65, 171
Sau3AI GATC 1 cut(s) 207
ScrFI CCNGG 1 cut(s) 158
SduI GDGCHC 1 cut(s) 17
SetI ASST 9 cut(s) 84, 110, 123, 141, 159, 168, 200, 224, 269
SfaNI GCATC 1 cut(s) 135
SfcI CTRYAG 1 cut(s) 127
SmlI CTYRAG 2 cut(s) 54, 116
SmoI CTYRAG 2 cut(s) 54, 116
Sse9I AATT 1 cut(s) 242
SsiI CCGC 3 cut(s) 65, 73, 171
StyD4I CCNGG 1 cut(s) 156
TaaI ACNGT 1 cut(s) 26
TaiI ACGT 1 cut(s) 110
TasI AATT 1 cut(s) 242
TauI GCSGC 2 cut(s) 67, 173
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 1 cut(s) 239
Tru9I TTAA 1 cut(s) 239
XapI RAATTY 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.