RchiOBHm_Chr4g0444371

Anticodon-binding domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
65140314 .. 65140524
211 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41206

Sequence Viewer

Length: 153 bp
ATGGCCATGGATGGCAGCAATGCAGCAGCAGCGGAGGAATTGGCCGTGGGTTGCTTCGTCTCCATCAAGACCACCTTGGGCGACGACTTCCAGGGCCAGGTCATCACCTTCGACCGCCCCTCCAACATCCTCATCCTTCATATCCTTCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.29

Weight (kDa)

4.23

Isoelectric Point (pI)

56.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LSM12_LSM PF21166 12 - 47 2.9e-10 LSM12, LSM domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 32, 115
AcoI YGGCCR 2 cut(s) 3, 42
AfiI CCNNNNNNNGG 1 cut(s) 97
AjnI CCWGG 2 cut(s) 90, 96
Alw26I GTCTC 1 cut(s) 64
AoxI GGCC 3 cut(s) 3, 42, 94
ApeKI GCWGC 4 cut(s) 15, 23, 26, 29
AspS9I GGNCC 1 cut(s) 94
AsuHPI GGTGA 1 cut(s) 97
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 4 cut(s) 27, 35, 38, 41
BccI CCATC 2 cut(s) 5, 71
BceAI ACGGC 1 cut(s) 29
BciT130I CCWGG 2 cut(s) 92, 98
BcoDI GTCTC 1 cut(s) 64
BisI GCNGC 4 cut(s) 16, 24, 27, 30
BlsI GCNGC 4 cut(s) 17, 25, 28, 31
Bme1390I CCNGG 2 cut(s) 92, 98
BmgT120I GGNCC 1 cut(s) 94
BmrFI CCNGG 2 cut(s) 92, 98
BsaJI CCNNGG 4 cut(s) 6, 45, 75, 91
BsaXI ACNNNNNCTCC 2 cut(s) 104, 134
Bsc4I CCNNNNNNNGG 1 cut(s) 97
Bse3DI GCAATG 1 cut(s) 25
BseBI CCWGG 2 cut(s) 92, 98
BseDI CCNNGG 4 cut(s) 6, 45, 75, 91
BseGI GGATG 3 cut(s) 16, 126, 132
BseLI CCNNNNNNNGG 1 cut(s) 97
BseMI GCAATG 1 cut(s) 25
BseXI GCAGC 4 cut(s) 27, 35, 38, 41
Bsh1285I CGRYCG 1 cut(s) 115
BshFI GGCC 3 cut(s) 5, 44, 96
BsiEI CGRYCG 1 cut(s) 115
BslI CCNNNNNNNGG 1 cut(s) 97
BsmAI GTCTC 1 cut(s) 64
BsmBI CGTCTC 1 cut(s) 64
BsnI GGCC 3 cut(s) 5, 44, 96
Bsp19I CCATGG 1 cut(s) 6
BspACI CCGC 2 cut(s) 32, 115
BspANI GGCC 3 cut(s) 5, 44, 96
BsrDI GCAATG 1 cut(s) 25
BssECI CCNNGG 4 cut(s) 6, 45, 75, 91
BssT1I CCWWGG 2 cut(s) 6, 75
Bst2UI CCWGG 2 cut(s) 92, 98
BstDSI CCRYGG 2 cut(s) 6, 45
BstF5I GGATG 3 cut(s) 16, 126, 132
BstMAI GTCTC 1 cut(s) 64
BstMCI CGRYCG 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 29
BstNI CCWGG 2 cut(s) 92, 98
BstSCI CCNGG 2 cut(s) 90, 96
BstV1I GCAGC 4 cut(s) 27, 35, 38, 41
BsuRI GGCC 3 cut(s) 5, 44, 96
BtgI CCRYGG 2 cut(s) 6, 45
BtsCI GGATG 3 cut(s) 16, 126, 132
Cfr13I GGNCC 1 cut(s) 94
CviAII CATG 1 cut(s) 7
CviJI RGCY 3 cut(s) 5, 44, 96
CviKI_1 RGCY 3 cut(s) 5, 44, 96
EaeI YGGCCR 2 cut(s) 3, 42
Eco130I CCWWGG 2 cut(s) 6, 75
EcoRII CCWGG 2 cut(s) 90, 96
EcoT14I CCWWGG 2 cut(s) 6, 75
ErhI CCWWGG 2 cut(s) 6, 75
Esp3I CGTCTC 1 cut(s) 64
FaeI CATG 1 cut(s) 10
FaiI YATR 2 cut(s) 8, 141
FalI AAGNNNNNCTT 2 cut(s) 59, 91
FatI CATG 1 cut(s) 6
Fnu4HI GCNGC 4 cut(s) 16, 24, 27, 30
FokI GGATG 3 cut(s) 23, 113, 119
Fsp4HI GCNGC 4 cut(s) 16, 24, 27, 30
GluI GCNGC 4 cut(s) 16, 24, 27, 30
HaeIII GGCC 3 cut(s) 5, 44, 96
Hin1II CATG 1 cut(s) 10
HphI GGTGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 67
Hpy99I CGWCG 1 cut(s) 86
HpyAV CCTTC 2 cut(s) 118, 146
HpyCH4V TGCA 1 cut(s) 23
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
Hsp92II CATG 1 cut(s) 10
LpnPI CCDG 4 cut(s) 77, 83, 104, 110
Lsp1109I GCAGC 4 cut(s) 27, 35, 38, 41
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 38
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 147
MnlI CCTC 3 cut(s) 28, 130, 140
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 32
MspR9I CCNGG 2 cut(s) 92, 98
MvaI CCWGG 2 cut(s) 92, 98
MwoI GCNNNNNNNGC 1 cut(s) 29
NcoI CCATGG 1 cut(s) 6
NlaIII CATG 1 cut(s) 10
PkrI GCNGC 4 cut(s) 17, 25, 28, 31
Psp6I CCWGG 2 cut(s) 90, 96
PspGI CCWGG 2 cut(s) 90, 96
PspPI GGNCC 1 cut(s) 94
SatI GCNGC 4 cut(s) 16, 24, 27, 30
Sau96I GGNCC 1 cut(s) 94
ScrFI CCNGG 2 cut(s) 92, 98
SetI ASST 3 cut(s) 77, 102, 110
SgeI CNNG 8 cut(s) 19, 58, 79, 88, 103, 104, 109, 110
Sse9I AATT 1 cut(s) 38
SsiI CCGC 2 cut(s) 32, 115
StyD4I CCNGG 2 cut(s) 90, 96
StyI CCWWGG 2 cut(s) 6, 75
TaqI TCGA 1 cut(s) 111
TasI AATT 1 cut(s) 38
TseI GCWGC 4 cut(s) 15, 23, 26, 29
TspDTI ATGAA 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.