Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000962.1

Orthogroup ID

OG0001597

Physical Location & Seq

Genomic Coordinates Reverse (-)

312211 .. 312697

Gene Structure 487 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000962.1_g000074.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

atggccagggatggcagcaatgcagcagcagcggaggaattggccatgggttgcttcgtctccatcaagaccaccttggacgacgacttccagggccaggtcatcaccttcgacctcccctccaacatcctcatccttcaagagggtttgaaaggagggcctaagcggaacatcaggctactcaaggccaactatatcaaggagttgagctatttgggtcaagctgaagacccacttgacattaagaactgttaccttgatcttaatagtctcagagccagagaggaatcagctatcagacaagcagaggcagagtgtgagaggatcggagttggtgtcaccagccaggcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

117

Amino Acids

12.79

Weight (kDa)

4.72

Isoelectric Point (pI)

46.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001597)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G24050 AT1G70220 AT1G70220
fragaria_vesca	FvH4_4g34930
malus_domestica	MD13G1087800.v1.1 MD16G1088100.v1.1
prunus_persica	Prupe.1G258500_v2.0.a1 Prupe.1G258600_v2.0.a1
pyrus_communis	pycom13g07550
rosa_chinensis	RchiOBHm_Chr1g0347741 RchiOBHm_Chr2g0143691 RchiOBHm_Chr3g0467191 RchiOBHm_Chr4g0444371 RchiOBHm_Chr4g0444381 RchiOBHm_Chr5g0030111 RchiOBHm_Chr7g0224821
rosa_laevigata	RLG00000005836
rosa_multiflora	Rmu_sc0000962.1_g000074 Rmu_sc0001209.1_g000005 Rmu_sc0006184.1_g000013 Rmu_sc0011110.1_g000001
rosa_roxburghii	Rroxscaffold_5G00369700 Rroxscaffold_5G00384910
rosa_rugosa	Rorug01G0030100 Rorug04G0111300 Rorug04G0352300 Rorug04G0352400
rosa_samantha	Rh1AG203300 Rh1CG051400 Rh1CG188600 Rh1DG055700 Rh3AG134000 Rh3BG155300 Rh4AG231500 Rh4AG412700 Rh4BG424200 Rh4CG438500 Rh4DG419500 Rh5DG213500 Rh6AG083500 Rh6BG138800 Rh6CG072700 Rh6CG136300 Rh6DG069900 Rh6DG122500 Rh7AG494600
rosa_wichuraiana	Rw1G006150 Rw1G007330 Rw3G012680 Rw4G035450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	32, 166
AclWI	GGATC	1 cut(s)	332
AcoI	YGGCCR	2 cut(s)	3, 42
AcuI	CTGAAG	1 cut(s)	246
AfiI	CCNNNNNNNGG	2 cut(s)	97, 142
AgsI	TTSAA	2 cut(s)	140, 151
AjnI	CCWGG	4 cut(s)	5, 90, 96, 345
AluBI	AGCT	3 cut(s)	210, 224, 293
AluI	AGCT	3 cut(s)	210, 224, 293
Alw26I	GTCTC	2 cut(s)	64, 275
AlwI	GGATC	1 cut(s)	332
AoxI	GGCC	5 cut(s)	3, 42, 94, 158, 186
ApeKI	GCWGC	4 cut(s)	15, 23, 26, 29
AspS9I	GGNCC	2 cut(s)	94, 158
AsuHPI	GGTGA	2 cut(s)	97, 331
BalI	TGGCCA	2 cut(s)	5, 44
BbsI	GAAGAC	1 cut(s)	234
BbvI	GCAGC	4 cut(s)	27, 35, 38, 41
BccI	CCATC	2 cut(s)	5, 71
BciT130I	CCWGG	4 cut(s)	7, 92, 98, 347
BcoDI	GTCTC	2 cut(s)	64, 275
BisI	GCNGC	4 cut(s)	16, 24, 27, 30
BlsI	GCNGC	4 cut(s)	17, 25, 28, 31
Bme1390I	CCNGG	4 cut(s)	7, 92, 98, 347
BmgT120I	GGNCC	2 cut(s)	94, 158
BmrFI	CCNGG	4 cut(s)	7, 92, 98, 347
BpiI	GAAGAC	1 cut(s)	234
Bpu10I	CCTNAGC	1 cut(s)	162
BpuEI	CTTGAG	1 cut(s)	167
BsaJI	CCNNGG	4 cut(s)	6, 45, 75, 91
BsaXI	ACNNNNNCTCC	4 cut(s)	104, 134, 321, 351
Bsc4I	CCNNNNNNNGG	2 cut(s)	97, 142
Bse3DI	GCAATG	1 cut(s)	25
BseBI	CCWGG	4 cut(s)	7, 92, 98, 347
BseDI	CCNNGG	4 cut(s)	6, 45, 75, 91
BseGI	GGATG	3 cut(s)	16, 126, 132
BseLI	CCNNNNNNNGG	2 cut(s)	97, 142
BseMI	GCAATG	1 cut(s)	25
BseMII	CTCAG	1 cut(s)	286
BseXI	GCAGC	4 cut(s)	27, 35, 38, 41
BshFI	GGCC	5 cut(s)	5, 44, 96, 160, 188
BslI	CCNNNNNNNGG	2 cut(s)	97, 142
BsmAI	GTCTC	2 cut(s)	64, 275
BsmBI	CGTCTC	1 cut(s)	64
BsnI	GGCC	5 cut(s)	5, 44, 96, 160, 188
Bsp143I	GATC	2 cut(s)	259, 324
Bsp19I	CCATGG	1 cut(s)	45
BspACI	CCGC	2 cut(s)	32, 166
BspANI	GGCC	5 cut(s)	5, 44, 96, 160, 188
BspCNI	CTCAG	1 cut(s)	285
BspPI	GGATC	1 cut(s)	332
BsrDI	GCAATG	1 cut(s)	25
BssECI	CCNNGG	4 cut(s)	6, 45, 75, 91
BssMI	GATC	2 cut(s)	259, 324
BssT1I	CCWWGG	2 cut(s)	45, 75
Bst2UI	CCWGG	4 cut(s)	7, 92, 98, 347
Bst4CI	ACNGT	1 cut(s)	251
BstDEI	CTNAG	3 cut(s)	162, 272, 351
BstDSI	CCRYGG	1 cut(s)	45
BstENI	CCTNNNNNAGG	1 cut(s)	140
BstF5I	GGATG	3 cut(s)	16, 126, 132
BstKTI	GATC	2 cut(s)	262, 327
BstMAI	GTCTC	2 cut(s)	64, 275
BstMBI	GATC	2 cut(s)	259, 324
BstMWI	GCNNNNNNNGC	1 cut(s)	29
BstNI	CCWGG	4 cut(s)	7, 92, 98, 347
BstSCI	CCNGG	4 cut(s)	5, 90, 96, 345
BstV1I	GCAGC	4 cut(s)	27, 35, 38, 41
BstV2I	GAAGAC	1 cut(s)	234
BsuRI	GGCC	5 cut(s)	5, 44, 96, 160, 188
BtgI	CCRYGG	1 cut(s)	45
BtsCI	GGATG	3 cut(s)	16, 126, 132
Cfr13I	GGNCC	2 cut(s)	94, 158
CviAII	CATG	1 cut(s)	46
DdeI	CTNAG	3 cut(s)	162, 272, 351
DpnI	GATC	2 cut(s)	261, 326
DpnII	GATC	2 cut(s)	259, 324
EaeI	YGGCCR	2 cut(s)	3, 42
Eco130I	CCWWGG	2 cut(s)	45, 75
Eco57I	CTGAAG	1 cut(s)	246
EcoNI	CCTNNNNNAGG	1 cut(s)	140
EcoO109I	RGGNCCY	1 cut(s)	158
EcoRII	CCWGG	4 cut(s)	5, 90, 96, 345
EcoT14I	CCWWGG	2 cut(s)	45, 75
ErhI	CCWWGG	2 cut(s)	45, 75
Esp3I	CGTCTC	1 cut(s)	64
FaeI	CATG	1 cut(s)	49
FaiI	YATR	2 cut(s)	47, 195
FalI	AAGNNNNNCTT	4 cut(s)	59, 91, 219, 251
FatI	CATG	1 cut(s)	45
Fnu4HI	GCNGC	4 cut(s)	16, 24, 27, 30
FokI	GGATG	3 cut(s)	23, 113, 119
Fsp4HI	GCNGC	4 cut(s)	16, 24, 27, 30
GluI	GCNGC	4 cut(s)	16, 24, 27, 30
HaeIII	GGCC	5 cut(s)	5, 44, 96, 160, 188
Hin1II	CATG	1 cut(s)	49
HinfI	GANTC	1 cut(s)	287
HphI	GGTGA	2 cut(s)	97, 331
Hpy188I	TCNGA	3 cut(s)	275, 299, 329
Hpy188III	TCNNGA	2 cut(s)	67, 140
Hpy99I	CGWCG	1 cut(s)	86
HpyAV	CCTTC	2 cut(s)	118, 146
HpyCH4III	ACNGT	1 cut(s)	251
HpyCH4V	TGCA	1 cut(s)	23
HpyF10VI	GCNNNNNNNGC	1 cut(s)	29
HpyF3I	CTNAG	3 cut(s)	162, 272, 351
Hsp92II	CATG	1 cut(s)	49
Kzo9I	GATC	2 cut(s)	259, 324
LpnPI	CCDG	8 cut(s)	19, 77, 83, 104, 110, 160, 292, 332
Lsp1109I	GCAGC	4 cut(s)	27, 35, 38, 41
MaeIII	GTNAC	2 cut(s)	251, 337
MalI	GATC	2 cut(s)	261, 326
MboI	GATC	2 cut(s)	259, 324
MboII	GAAGA	1 cut(s)	239
MlsI	TGGCCA	2 cut(s)	5, 44
MluCI	AATT	1 cut(s)	38
MluNI	TGGCCA	2 cut(s)	5, 44
MmeI	TCCRAC	1 cut(s)	147
MnlI	CCTC	9 cut(s)	28, 125, 130, 136, 140, 149, 277, 301, 315
Mox20I	TGGCCA	2 cut(s)	5, 44
MscI	TGGCCA	2 cut(s)	5, 44
MseI	TTAA	2 cut(s)	243, 264
Msp20I	TGGCCA	2 cut(s)	5, 44
MspA1I	CMGCKG	1 cut(s)	32
MspR9I	CCNGG	4 cut(s)	7, 92, 98, 347
MvaI	CCWGG	4 cut(s)	7, 92, 98, 347
MwoI	GCNNNNNNNGC	1 cut(s)	29
NcoI	CCATGG	1 cut(s)	45
NdeII	GATC	2 cut(s)	259, 324
NlaIII	CATG	1 cut(s)	49
NmuCI	GTSAC	1 cut(s)	337
PfeI	GAWTC	1 cut(s)	287
PkrI	GCNGC	4 cut(s)	17, 25, 28, 31
Psp6I	CCWGG	4 cut(s)	5, 90, 96, 345
PspGI	CCWGG	4 cut(s)	5, 90, 96, 345
PspPI	GGNCC	2 cut(s)	94, 158
SaqAI	TTAA	2 cut(s)	243, 264
SatI	GCNGC	4 cut(s)	16, 24, 27, 30
Sau3AI	GATC	2 cut(s)	259, 324
Sau96I	GGNCC	2 cut(s)	94, 158
ScrFI	CCNGG	4 cut(s)	7, 92, 98, 347
SetI	ASST	8 cut(s)	77, 102, 110, 117, 212, 226, 258, 295
SmlI	CTYRAG	1 cut(s)	182
SmoI	CTYRAG	1 cut(s)	182
Sse9I	AATT	1 cut(s)	38
SsiI	CCGC	2 cut(s)	32, 166
StyD4I	CCNGG	4 cut(s)	5, 90, 96, 345
StyI	CCWWGG	2 cut(s)	45, 75
TaaI	ACNGT	1 cut(s)	251
TaqI	TCGA	1 cut(s)	111
TasI	AATT	1 cut(s)	38
TfiI	GAWTC	1 cut(s)	287
Tru1I	TTAA	2 cut(s)	243, 264
Tru9I	TTAA	2 cut(s)	243, 264
TseFI	GTSAC	1 cut(s)	337
TseI	GCWGC	4 cut(s)	15, 23, 26, 29
Tsp45I	GTSAC	1 cut(s)	337
XagI	CCTNNNNNAGG	1 cut(s)	140

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.