Rmu_sc0001209.1_g000005

Anticodon-binding domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001209.1
Physical Location & Seq
Forward (+)
18832 .. 19840
1009 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001209.1_g000005.1.cds

Sequence Viewer

Length: 594 bp
atggccagggatggcagcaatgcagcaatagcggaggaattggccgtgggttgcttcgtctccatcaagaccaccttgggcgacgacttccagggccaggtcatcaccttcgaccgcccctccaacatcctcatccttcaagagggtttgaaaggagggcctaagcggaacatcaggctactcaaggccaactatatcaaggagttgagctatttgggtcaagctgaagacccacttgatagtaagaactgttaccttgatcttaatagtctcagagccagagaggaatcagctatcagacaagcagaggcagagtgtgagaggatcggagttggtgtcaccagccaggctcagaacattttcgatgccttgtctaagactccatatcttcccgagtctgtcagtggaggaactcctgctgcccatgatcgggtgaagaaagtgcttgagttggagaagacttttccctcaagggataagtcattgtggctcaagataaattgtttaatcatggtggtaaaattgattaaatgcaagtatggtggtatggtggtcttgctgacaagacgtaagaccaagcatgaagtgttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

197

Amino Acids

21.82

Weight (kDa)

8.93

Isoelectric Point (pI)

44.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 32, 115, 166
AclWI GGATC 1 cut(s) 332
AcoI YGGCCR 2 cut(s) 3, 42
AcuI CTGAAG 1 cut(s) 246
AfiI CCNNNNNNNGG 4 cut(s) 97, 142, 429, 430
AgsI TTSAA 2 cut(s) 140, 151
AjnI CCWGG 4 cut(s) 5, 90, 96, 345
AluBI AGCT 3 cut(s) 210, 224, 293
AluI AGCT 3 cut(s) 210, 224, 293
Alw26I GTCTC 2 cut(s) 64, 275
AlwI GGATC 1 cut(s) 332
Ama87I CYCGRG 1 cut(s) 392
AoxI GGCC 5 cut(s) 3, 42, 94, 158, 186
ApeKI GCWGC 3 cut(s) 15, 23, 419
Asp700I GAANNNNTTC 1 cut(s) 359
AspS9I GGNCC 2 cut(s) 94, 158
AsuHPI GGTGA 3 cut(s) 97, 331, 445
AvaI CYCGRG 1 cut(s) 392
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 2 cut(s) 234, 464
BbvI GCAGC 3 cut(s) 27, 35, 406
BccI CCATC 2 cut(s) 5, 71
BceAI ACGGC 1 cut(s) 29
BciT130I CCWGG 4 cut(s) 7, 92, 98, 347
BcoDI GTCTC 2 cut(s) 64, 275
BisI GCNGC 3 cut(s) 16, 24, 420
BlsI GCNGC 3 cut(s) 17, 25, 421
Bme1390I CCNGG 4 cut(s) 7, 92, 98, 347
BmeT110I CYCGRG 1 cut(s) 392
BmgT120I GGNCC 2 cut(s) 94, 158
BmrFI CCNGG 4 cut(s) 7, 92, 98, 347
BmsI GCATC 1 cut(s) 355
BpiI GAAGAC 2 cut(s) 234, 464
Bpu10I CCTNAGC 1 cut(s) 162
BpuEI CTTGAG 4 cut(s) 167, 454, 467, 476
BsaJI CCNNGG 4 cut(s) 6, 45, 75, 91
BsaXI ACNNNNNCTCC 4 cut(s) 104, 134, 321, 351
Bsc4I CCNNNNNNNGG 4 cut(s) 97, 142, 429, 430
Bse3DI GCAATG 1 cut(s) 25
BseBI CCWGG 4 cut(s) 7, 92, 98, 347
BseDI CCNNGG 4 cut(s) 6, 45, 75, 91
BseGI GGATG 3 cut(s) 16, 126, 132
BseLI CCNNNNNNNGG 4 cut(s) 97, 142, 429, 430
BseMI GCAATG 1 cut(s) 25
BseMII CTCAG 2 cut(s) 286, 365
BseXI GCAGC 3 cut(s) 27, 35, 406
Bsh1285I CGRYCG 1 cut(s) 115
BshFI GGCC 5 cut(s) 5, 44, 96, 160, 188
BsiEI CGRYCG 1 cut(s) 115
BsiHKCI CYCGRG 1 cut(s) 392
BslI CCNNNNNNNGG 4 cut(s) 97, 142, 429, 430
BsmAI GTCTC 2 cut(s) 64, 275
BsmBI CGTCTC 1 cut(s) 64
BsnI GGCC 5 cut(s) 5, 44, 96, 160, 188
BsoBI CYCGRG 1 cut(s) 392
Bsp143I GATC 3 cut(s) 259, 324, 427
BspACI CCGC 3 cut(s) 32, 115, 166
BspANI GGCC 5 cut(s) 5, 44, 96, 160, 188
BspCNI CTCAG 2 cut(s) 285, 364
BspPI GGATC 1 cut(s) 332
BsrDI GCAATG 1 cut(s) 25
BssECI CCNNGG 4 cut(s) 6, 45, 75, 91
BssMI GATC 3 cut(s) 259, 324, 427
BssT1I CCWWGG 1 cut(s) 75
Bst2UI CCWGG 4 cut(s) 7, 92, 98, 347
Bst4CI ACNGT 1 cut(s) 251
BstDEI CTNAG 4 cut(s) 162, 272, 351, 375
BstDSI CCRYGG 1 cut(s) 45
BstENI CCTNNNNNAGG 1 cut(s) 140
BstF5I GGATG 3 cut(s) 16, 126, 132
BstKTI GATC 3 cut(s) 262, 327, 430
BstMAI GTCTC 2 cut(s) 64, 275
BstMBI GATC 3 cut(s) 259, 324, 427
BstMCI CGRYCG 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 29
BstNI CCWGG 4 cut(s) 7, 92, 98, 347
BstSCI CCNGG 4 cut(s) 5, 90, 96, 345
BstV1I GCAGC 3 cut(s) 27, 35, 406
BstV2I GAAGAC 2 cut(s) 234, 464
BsuRI GGCC 5 cut(s) 5, 44, 96, 160, 188
BtgI CCRYGG 1 cut(s) 45
BtsCI GGATG 3 cut(s) 16, 126, 132
BtsIMutI CAGTG 1 cut(s) 409
Cfr13I GGNCC 2 cut(s) 94, 158
CspCI CAANNNNNGTGG 2 cut(s) 523, 558
CviAII CATG 3 cut(s) 425, 511, 581
DdeI CTNAG 4 cut(s) 162, 272, 351, 375
DpnI GATC 3 cut(s) 261, 326, 429
DpnII GATC 3 cut(s) 259, 324, 427
EaeI YGGCCR 2 cut(s) 3, 42
Eco130I CCWWGG 1 cut(s) 75
Eco57I CTGAAG 1 cut(s) 246
Eco88I CYCGRG 1 cut(s) 392
EcoNI CCTNNNNNAGG 1 cut(s) 140
EcoO109I RGGNCCY 1 cut(s) 158
EcoRII CCWGG 4 cut(s) 5, 90, 96, 345
EcoT14I CCWWGG 1 cut(s) 75
ErhI CCWWGG 1 cut(s) 75
Esp3I CGTCTC 1 cut(s) 64
FaeI CATG 3 cut(s) 428, 514, 584
FaiI YATR 7 cut(s) 195, 385, 426, 512, 540, 548, 582
FalI AAGNNNNNCTT 4 cut(s) 59, 91, 219, 251
FatI CATG 3 cut(s) 424, 510, 580
Fnu4HI GCNGC 3 cut(s) 16, 24, 420
FokI GGATG 3 cut(s) 23, 113, 119
Fsp4HI GCNGC 3 cut(s) 16, 24, 420
GluI GCNGC 3 cut(s) 16, 24, 420
HaeIII GGCC 5 cut(s) 5, 44, 96, 160, 188
Hin1II CATG 3 cut(s) 428, 514, 584
HinfI GANTC 3 cut(s) 287, 379, 395
HphI GGTGA 3 cut(s) 97, 331, 445
Hpy188I TCNGA 4 cut(s) 275, 299, 329, 354
Hpy188III TCNNGA 4 cut(s) 67, 140, 392, 493
Hpy99I CGWCG 1 cut(s) 86
HpyAV CCTTC 2 cut(s) 118, 146
HpyCH4III ACNGT 1 cut(s) 251
HpyCH4IV ACGT 1 cut(s) 568
HpyCH4V TGCA 2 cut(s) 23, 534
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
HpyF3I CTNAG 4 cut(s) 162, 272, 351, 375
HpySE526I ACGT 1 cut(s) 568
Hsp92II CATG 3 cut(s) 428, 514, 584
Kzo9I GATC 3 cut(s) 259, 324, 427
Lsp1109I GCAGC 3 cut(s) 27, 35, 406
LweI GCATC 1 cut(s) 355
MaeII ACGT 1 cut(s) 568
MaeIII GTNAC 2 cut(s) 251, 337
MalI GATC 3 cut(s) 261, 326, 429
MboI GATC 3 cut(s) 259, 324, 427
MboII GAAGA 4 cut(s) 239, 380, 448, 469
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 38, 499, 521
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 2 cut(s) 373, 404
MmeI TCCRAC 2 cut(s) 147, 432
Mox20I TGGCCA 1 cut(s) 5
MroXI GAANNNNTTC 1 cut(s) 359
MscI TGGCCA 1 cut(s) 5
MseI TTAA 3 cut(s) 264, 506, 528
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 4 cut(s) 7, 92, 98, 347
MvaI CCWGG 4 cut(s) 7, 92, 98, 347
MwoI GCNNNNNNNGC 1 cut(s) 29
NdeII GATC 3 cut(s) 259, 324, 427
NlaIII CATG 3 cut(s) 428, 514, 584
NmuCI GTSAC 1 cut(s) 337
PdmI GAANNNNTTC 1 cut(s) 359
PfeI GAWTC 1 cut(s) 287
PkrI GCNGC 3 cut(s) 17, 25, 421
PleI GAGTC 2 cut(s) 373, 403
PpsI GAGTC 2 cut(s) 373, 403
Psp6I CCWGG 4 cut(s) 5, 90, 96, 345
PspGI CCWGG 4 cut(s) 5, 90, 96, 345
PspPI GGNCC 2 cut(s) 94, 158
SaqAI TTAA 3 cut(s) 264, 506, 528
SatI GCNGC 3 cut(s) 16, 24, 420
Sau3AI GATC 3 cut(s) 259, 324, 427
Sau96I GGNCC 2 cut(s) 94, 158
SchI GAGTC 2 cut(s) 373, 404
ScrFI CCNGG 4 cut(s) 7, 92, 98, 347
SetI ASST 8 cut(s) 77, 102, 110, 212, 226, 258, 295, 571
SfaNI GCATC 1 cut(s) 355
SmlI CTYRAG 4 cut(s) 182, 446, 469, 491
SmoI CTYRAG 4 cut(s) 182, 446, 469, 491
Sse9I AATT 3 cut(s) 38, 499, 521
SsiI CCGC 3 cut(s) 32, 115, 166
StyD4I CCNGG 4 cut(s) 5, 90, 96, 345
StyI CCWWGG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 251
TaiI ACGT 1 cut(s) 571
TaqI TCGA 2 cut(s) 111, 363
TasI AATT 3 cut(s) 38, 499, 521
TfiI GAWTC 1 cut(s) 287
Tru1I TTAA 3 cut(s) 264, 506, 528
Tru9I TTAA 3 cut(s) 264, 506, 528
TscAI CASTG 1 cut(s) 409
TseFI GTSAC 1 cut(s) 337
TseI GCWGC 3 cut(s) 15, 23, 419
Tsp45I GTSAC 1 cut(s) 337
TspRI CASTG 1 cut(s) 409
XagI CCTNNNNNAGG 1 cut(s) 140
XmnI GAANNNNTTC 1 cut(s) 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.