RchiOBHm_Chr5g0004661

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000773
Physical Location & Seq
Reverse (-)
3052297 .. 3054744
2448 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28589

Sequence Viewer

Length: 147 bp
ATGGGGAGGACACCAGCCTTGTCACTCCCACTCTCGGCTTCAACATCAACACCCTCACTTACCAAAACTCCAACTTCAATGGGGAAACAAGAGGCATCCGTAAGTGTTGAATTTATCATGAAGATCCAAGTAAAGCTGTTCTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

48

Amino Acids

5.15

Weight (kDa)

10.0

Isoelectric Point (pI)

23.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 118
AcsI RAATTY 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 34
AgsI TTSAA 3 cut(s) 42, 78, 110
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
AlwI GGATC 1 cut(s) 118
ApoI RAATTY 1 cut(s) 110
BmsI GCATC 1 cut(s) 104
BsaXI ACNNNNNCTCC 2 cut(s) 52, 82
Bsc4I CCNNNNNNNGG 1 cut(s) 34
BseGI GGATG 1 cut(s) 95
BseLI CCNNNNNNNGG 1 cut(s) 34
BslI CCNNNNNNNGG 1 cut(s) 34
Bsp143I GATC 1 cut(s) 123
BspHI TCATGA 1 cut(s) 117
BspPI GGATC 1 cut(s) 118
BssMI GATC 1 cut(s) 123
BstF5I GGATG 1 cut(s) 95
BstKTI GATC 1 cut(s) 126
BstMBI GATC 1 cut(s) 123
BstX2I RGATCY 1 cut(s) 123
BstYI RGATCY 1 cut(s) 123
BtsCI GGATG 1 cut(s) 95
CciI TCATGA 1 cut(s) 117
CviAII CATG 1 cut(s) 118
CviJI RGCY 3 cut(s) 17, 38, 136
CviKI_1 RGCY 3 cut(s) 17, 38, 136
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
FaeI CATG 1 cut(s) 121
FaiI YATR 1 cut(s) 119
FalI AAGNNNNNCTT 1 cut(s) 125
FatI CATG 1 cut(s) 117
FokI GGATG 1 cut(s) 82
Hin1II CATG 1 cut(s) 121
Hpy188III TCNNGA 1 cut(s) 118
Hsp92II CATG 1 cut(s) 121
Kzo9I GATC 1 cut(s) 123
LpnPI CCDG 1 cut(s) 27
LweI GCATC 1 cut(s) 104
MaeIII GTNAC 1 cut(s) 21
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 1 cut(s) 133
MflI RGATCY 1 cut(s) 123
MluCI AATT 1 cut(s) 110
MmeI TCCRAC 1 cut(s) 95
MnlI CCTC 2 cut(s) 64, 85
MseI TTAA 1 cut(s) 145
NdeII GATC 1 cut(s) 123
NlaIII CATG 1 cut(s) 121
NmeAIII GCCGAG 1 cut(s) 14
NmuCI GTSAC 1 cut(s) 21
PagI TCATGA 1 cut(s) 117
PsuI RGATCY 1 cut(s) 123
SaqAI TTAA 1 cut(s) 145
Sau3AI GATC 1 cut(s) 123
SetI ASST 1 cut(s) 138
SfaNI GCATC 1 cut(s) 104
SgeI CNNG 6 cut(s) 26, 31, 46, 101, 130, 140
Sse9I AATT 1 cut(s) 110
TasI AATT 1 cut(s) 110
Tru1I TTAA 1 cut(s) 145
Tru9I TTAA 1 cut(s) 145
TseFI GTSAC 1 cut(s) 21
Tsp45I GTSAC 1 cut(s) 21
TspDTI ATGAA 1 cut(s) 134
TspGWI ACGGA 1 cut(s) 88
XapI RAATTY 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.