RchiOBHm_Chr6g0264421
ERF Family

Belongs to the small GTPase superfamily. Arf family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
19554316 .. 19555289
974 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23716

Sequence Viewer

Length: 141 bp
ATGGTTGGGGTTGACAATTCGGGCAAGACTACGATTGTGCTCACGATTAATGGGGAGGACACCAGCCTTGTCACTCCCACTCTCGGCTTCAACATCAACAACCTCACTTACCAAAAAGGTTATCAGGATCGTCCTTATTGA

Protein Analysis

46

Amino Acids

5.05

Weight (kDa)

4.68

Isoelectric Point (pI)

7.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 1 - 39 3.8e-09 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 135
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 1 cut(s) 91
Alw21I GWGCWC 1 cut(s) 42
AlwI GGATC 1 cut(s) 135
AseI ATTAAT 1 cut(s) 48
Bbv12I GWGCWC 1 cut(s) 42
Bsc4I CCNNNNNNNGG 1 cut(s) 83
BseLI CCNNNNNNNGG 1 cut(s) 83
BsiHKAI GWGCWC 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 83
Bsp1286I GDGCHC 1 cut(s) 42
Bsp143I GATC 1 cut(s) 127
BspPI GGATC 1 cut(s) 135
BssMI GATC 1 cut(s) 127
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
CviJI RGCY 2 cut(s) 66, 87
CviKI_1 RGCY 2 cut(s) 66, 87
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
HincII GTYRAC 1 cut(s) 13
HindII GTYRAC 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 13
Hpy188III TCNNGA 2 cut(s) 43, 125
Hpy8I GTNNAC 1 cut(s) 13
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 76, 110
MaeIII GTNAC 1 cut(s) 70
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MhlI GDGCHC 1 cut(s) 42
MluCI AATT 1 cut(s) 16
MnlI CCTC 2 cut(s) 49, 113
MseI TTAA 1 cut(s) 48
NdeII GATC 1 cut(s) 127
NmeAIII GCCGAG 1 cut(s) 63
NmuCI GTSAC 1 cut(s) 70
PshBI ATTAAT 1 cut(s) 48
SaqAI TTAA 1 cut(s) 48
Sau3AI GATC 1 cut(s) 127
SduI GDGCHC 1 cut(s) 42
SetI ASST 2 cut(s) 105, 121
SgeI CNNG 7 cut(s) 33, 37, 55, 75, 80, 95, 137
Sse9I AATT 1 cut(s) 16
TasI AATT 1 cut(s) 16
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TseFI GTSAC 1 cut(s) 70
Tsp45I GTSAC 1 cut(s) 70
VspI ATTAAT 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.