RchiOBHm_Chr5g0066751

Belongs to the argonaute family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
72851850 .. 72852796
947 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34250

Sequence Viewer

Length: 150 bp
ATGCTCTATCAAACATATTCTTCTAAACTTGCTGATAACAAGTTTGTGTATGATGAAGAGAAAGCTCTATATACAGTTGGTCCTCTTCCGCAGAACAAGCTTGACTTTACAGTTCCCCTGGAGGAGACATTTGCAAAGAGAAAAATGTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

49

Amino Acids

5.76

Weight (kDa)

6.11

Isoelectric Point (pI)

57.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ArgoN PF16486 4 - 42 3.4e-06 N-terminal domain of argonaute
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AjnI CCWGG 1 cut(s) 117
AluBI AGCT 2 cut(s) 65, 100
AluI AGCT 2 cut(s) 65, 100
Alw26I GTCTC 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 80
AvaII GGWCC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 119
BcoDI GTCTC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 119
Bme18I GGWCC 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 119
BpmI CTGGAG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 119
BseDI CCNNGG 1 cut(s) 117
BseRI GAGGAG 1 cut(s) 137
BsmAI GTCTC 1 cut(s) 119
BspACI CCGC 1 cut(s) 89
BssECI CCNNGG 1 cut(s) 117
Bst2UI CCWGG 1 cut(s) 119
Bst4CI ACNGT 2 cut(s) 76, 112
Bst6I CTCTTC 2 cut(s) 51, 90
BstMAI GTCTC 1 cut(s) 119
BstMWI GCNNNNNNNGC 1 cut(s) 97
BstNI CCWGG 1 cut(s) 119
BstSCI CCNGG 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 80
CviJI RGCY 2 cut(s) 65, 100
CviKI_1 RGCY 2 cut(s) 65, 100
Eam1104I CTCTTC 2 cut(s) 51, 90
EarI CTCTTC 2 cut(s) 51, 90
Eco47I GGWCC 1 cut(s) 80
EcoRII CCWGG 1 cut(s) 117
FaiI YATR 4 cut(s) 16, 51, 70, 72
FalI AAGNNNNNCTT 2 cut(s) 89, 121
FspEI CC 8 cut(s) 63, 96, 102, 104, 107, 129, 130, 131
GsuI CTGGAG 1 cut(s) 140
HindIII AAGCTT 1 cut(s) 98
HpyCH4III ACNGT 2 cut(s) 76, 112
HpyCH4V TGCA 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
LpnPI CCDG 2 cut(s) 104, 131
MboII GAAGA 3 cut(s) 12, 68, 77
MnlI CCTC 2 cut(s) 93, 115
MspR9I CCNGG 1 cut(s) 119
MvaI CCWGG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 117
PspGI CCWGG 1 cut(s) 117
PspPI GGNCC 1 cut(s) 80
Sau96I GGNCC 1 cut(s) 80
ScrFI CCNGG 1 cut(s) 119
SetI ASST 2 cut(s) 67, 102
SgeI CNNG 6 cut(s) 41, 52, 109, 113, 130, 131
SinI GGWCC 1 cut(s) 80
SsiI CCGC 1 cut(s) 89
StyD4I CCNGG 1 cut(s) 117
TaaI ACNGT 2 cut(s) 76, 112
TspDTI ATGAA 1 cut(s) 69
VpaK11BI GGWCC 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.