Rh2AG451400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
66545331 .. 66562923
17593 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG451400.1

Sequence Viewer

Length: 285 bp
ATGAATTGGATATTGAAACTCTGCCATCCAGATACCTGCACGACACTTCTGCACATTTCAAAATACTTCAACCAGATAAAGATAGAAGAGAAGGCATTTGTAGTTGAGGAGAACTATGAGGTTGAGGAGTTGTATTCATTGGACATTGATTCTCTGAACAATCTGAGGACCTTTTATATACCAAGTCAGAAGCCAACTGACGCCAACCAAGTCAGGACCAAATTTTGTGATGCATTGCAGTACCTCTCTTACGACTTCAGGGATAAATGGCATCTGAACCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

11.32

Weight (kDa)

5.22

Isoelectric Point (pI)

47.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 44
AcsI RAATTY 1 cut(s) 221
AcuI CTGAAG 1 cut(s) 241
AcyI GRCGYC 1 cut(s) 201
AfaI GTAC 1 cut(s) 242
AgsI TTSAA 3 cut(s) 16, 60, 70
ApoI RAATTY 1 cut(s) 221
AspS9I GGNCC 2 cut(s) 168, 216
AvaII GGWCC 2 cut(s) 168, 216
BccI CCATC 1 cut(s) 33
BcgI CGANNNNNNTGC 2 cut(s) 31, 65
BfuAI ACCTGC 1 cut(s) 44
Bme18I GGWCC 2 cut(s) 168, 216
BmgT120I GGNCC 2 cut(s) 168, 216
BmsI GCATC 2 cut(s) 220, 280
BsaHI GRCGYC 1 cut(s) 201
Bse3DI GCAATG 1 cut(s) 233
BseGI GGATG 1 cut(s) 25
BseMI GCAATG 1 cut(s) 233
BseMII CTCAG 1 cut(s) 155
BseRI GAGGAG 2 cut(s) 122, 140
BsgI GTGCAG 2 cut(s) 22, 35
BspCNI CTCAG 1 cut(s) 156
BspMI ACCTGC 1 cut(s) 44
BsrDI GCAATG 1 cut(s) 233
BssNI GRCGYC 1 cut(s) 201
Bst6I CTCTTC 1 cut(s) 81
BstACI GRCGYC 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 164
BstF5I GGATG 1 cut(s) 25
BtsCI GGATG 1 cut(s) 25
BveI ACCTGC 1 cut(s) 44
Cfr13I GGNCC 2 cut(s) 168, 216
CseI GACGC 1 cut(s) 209
Csp6I GTAC 1 cut(s) 241
CviJI RGCY 1 cut(s) 193
CviKI_1 RGCY 1 cut(s) 193
CviQI GTAC 1 cut(s) 241
DdeI CTNAG 1 cut(s) 164
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco47I GGWCC 2 cut(s) 168, 216
Eco57I CTGAAG 1 cut(s) 241
EcoO109I RGGNCCY 1 cut(s) 168
EcoT22I ATGCAT 1 cut(s) 235
FaiI YATR 3 cut(s) 117, 177, 179
FokI GGATG 1 cut(s) 12
HgaI GACGC 1 cut(s) 209
Hin1I GRCGYC 1 cut(s) 201
HinfI GANTC 1 cut(s) 149
Hpy188I TCNGA 4 cut(s) 156, 165, 189, 276
Hpy188III TCNNGA 2 cut(s) 29, 214
HpyAV CCTTC 1 cut(s) 85
HpyCH4V TGCA 4 cut(s) 39, 52, 233, 238
HpyF3I CTNAG 1 cut(s) 164
Hsp92I GRCGYC 1 cut(s) 201
LpnPI CCDG 5 cut(s) 42, 49, 86, 199, 244
LweI GCATC 2 cut(s) 220, 280
MboII GAAGA 1 cut(s) 98
MluCI AATT 2 cut(s) 4, 221
MnlI CCTC 5 cut(s) 100, 112, 118, 159, 254
Mph1103I ATGCAT 1 cut(s) 235
NsiI ATGCAT 1 cut(s) 235
PfeI GAWTC 1 cut(s) 149
PpuMI RGGWCCY 1 cut(s) 168
Psp5II RGGWCCY 1 cut(s) 168
PspPI GGNCC 2 cut(s) 168, 216
PspPPI RGGWCCY 1 cut(s) 168
RsaI GTAC 1 cut(s) 242
RsaNI GTAC 1 cut(s) 241
Sau96I GGNCC 2 cut(s) 168, 216
SetI ASST 5 cut(s) 38, 123, 173, 246, 282
SfaNI GCATC 2 cut(s) 220, 280
SgeI CNNG 8 cut(s) 41, 48, 52, 85, 195, 221, 226, 271
SinI GGWCC 2 cut(s) 168, 216
Sse9I AATT 2 cut(s) 4, 221
TasI AATT 2 cut(s) 4, 221
TfiI GAWTC 1 cut(s) 149
TspDTI ATGAA 2 cut(s) 17, 126
VpaK11BI GGWCC 2 cut(s) 168, 216
XapI RAATTY 1 cut(s) 221
Zsp2I ATGCAT 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.