RchiOBHm_Chr6g0272631

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
32991036 .. 32995904
4869 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24459

Sequence Viewer

Length: 213 bp
ATGATAAAGAGAAAGCTCTATATACAGTTGGTCCTCTGCCGCAGAACAAGCTTGACTTTACAGTTCCCCTGGAGGAGACATTTGCAAAGAGACCACAATAAAGTTCCTTGGTTTGCTGAGTTCTCCTTTGGTTTGATCAAGGGCTATGGTTTTGGTGGATTTCGACAGATTGAGGATTGCAGGTGTCAAGCTCTGGGTATGGTCACAATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.38

Weight (kDa)

10.3

Isoelectric Point (pI)

56.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 171
Acc36I ACCTGC 1 cut(s) 171
AciI CCGC 1 cut(s) 40
AjnI CCWGG 1 cut(s) 68
AluBI AGCT 3 cut(s) 16, 51, 191
AluI AGCT 3 cut(s) 16, 51, 191
Alw26I GTCTC 2 cut(s) 70, 84
AspS9I GGNCC 1 cut(s) 31
AvaII GGWCC 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 70
BclI TGATCA 1 cut(s) 135
BcoDI GTCTC 2 cut(s) 70, 84
BfuAI ACCTGC 1 cut(s) 171
BisI GCNGC 1 cut(s) 40
BlsI GCNGC 1 cut(s) 41
Bme1390I CCNGG 1 cut(s) 70
Bme18I GGWCC 1 cut(s) 31
BmgT120I GGNCC 1 cut(s) 31
BmrFI CCNGG 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 91
BsaI GGTCTC 1 cut(s) 84
BsaJI CCNNGG 2 cut(s) 68, 107
BseBI CCWGG 1 cut(s) 70
BseDI CCNNGG 2 cut(s) 68, 107
BseMII CTCAG 1 cut(s) 108
BseRI GAGGAG 1 cut(s) 88
BsmAI GTCTC 2 cut(s) 70, 84
Bso31I GGTCTC 1 cut(s) 84
Bsp143I GATC 1 cut(s) 135
BspACI CCGC 1 cut(s) 40
BspCNI CTCAG 1 cut(s) 109
BspMI ACCTGC 1 cut(s) 171
BspTNI GGTCTC 1 cut(s) 84
BssECI CCNNGG 2 cut(s) 68, 107
BssMI GATC 1 cut(s) 135
BssT1I CCWWGG 1 cut(s) 107
Bst2UI CCWGG 1 cut(s) 70
Bst4CI ACNGT 2 cut(s) 27, 63
BstDEI CTNAG 1 cut(s) 117
BstKTI GATC 1 cut(s) 138
BstMAI GTCTC 2 cut(s) 70, 84
BstMBI GATC 1 cut(s) 135
BstMWI GCNNNNNNNGC 1 cut(s) 48
BstNI CCWGG 1 cut(s) 70
BstSCI CCNGG 1 cut(s) 68
BveI ACCTGC 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 31
CviJI RGCY 4 cut(s) 16, 51, 144, 191
CviKI_1 RGCY 4 cut(s) 16, 51, 144, 191
DdeI CTNAG 1 cut(s) 117
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
Eco130I CCWWGG 1 cut(s) 107
Eco31I GGTCTC 1 cut(s) 84
Eco47I GGWCC 1 cut(s) 31
EcoRII CCWGG 1 cut(s) 68
EcoT14I CCWWGG 1 cut(s) 107
ErhI CCWWGG 1 cut(s) 107
FaiI YATR 4 cut(s) 21, 23, 147, 200
FalI AAGNNNNNCTT 2 cut(s) 40, 72
FbaI TGATCA 1 cut(s) 135
Fnu4HI GCNGC 1 cut(s) 40
Fsp4HI GCNGC 1 cut(s) 40
GluI GCNGC 1 cut(s) 40
GsuI CTGGAG 1 cut(s) 91
HindIII AAGCTT 1 cut(s) 49
HpyCH4III ACNGT 2 cut(s) 27, 63
HpyCH4V TGCA 2 cut(s) 85, 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
HpyF3I CTNAG 1 cut(s) 117
Ksp22I TGATCA 1 cut(s) 135
Kzo9I GATC 1 cut(s) 135
LpnPI CCDG 4 cut(s) 55, 82, 166, 179
MaeIII GTNAC 1 cut(s) 202
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MnlI CCTC 3 cut(s) 44, 66, 166
MspR9I CCNGG 1 cut(s) 70
MvaI CCWGG 1 cut(s) 70
MwoI GCNNNNNNNGC 1 cut(s) 48
NdeII GATC 1 cut(s) 135
NmuCI GTSAC 1 cut(s) 202
PaqCI CACCTGC 1 cut(s) 171
PkrI GCNGC 1 cut(s) 41
Psp6I CCWGG 1 cut(s) 68
PspGI CCWGG 1 cut(s) 68
PspPI GGNCC 1 cut(s) 31
SatI GCNGC 1 cut(s) 40
Sau3AI GATC 1 cut(s) 135
Sau96I GGNCC 1 cut(s) 31
ScrFI CCNGG 1 cut(s) 70
SetI ASST 4 cut(s) 18, 53, 185, 193
SgeI CNNG 9 cut(s) 60, 64, 81, 82, 120, 151, 193, 200, 206
SinI GGWCC 1 cut(s) 31
SsiI CCGC 1 cut(s) 40
StyD4I CCNGG 1 cut(s) 68
StyI CCWWGG 1 cut(s) 107
TaaI ACNGT 2 cut(s) 27, 63
TaqI TCGA 1 cut(s) 163
TauI GCSGC 1 cut(s) 42
TseFI GTSAC 1 cut(s) 202
Tsp45I GTSAC 1 cut(s) 202
VpaK11BI GGWCC 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.