Rroxscaffold_3G00274360

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0002050
Physical Location & Seq
Forward (+)
66069986 .. 66074563
4578 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00274360.1

Sequence Viewer

Length: 303 bp
ATGGCAGCAAAACCGGAAGAAACAGAAATAAGGAGACATTTACGTCATCAGAATGGAGAAGGCCAAGCTTCTGGTCCTATTTCTGATATGGAGAAAGGTCGACAAATTAGATCAAGAAGGTGGAGACAACGTTCTATGCAAACGATTATTTGTATTGTTCAGTTGCTACTTTTCTTGGTCTGTATTAAGATTGGTCATTGTCTAGATATCAGTAACAGTGTGCAATCGGAATTTGAAAGTGCTTTGAACTTGGATCATAAAGGATGGTGGATGTGGCTGCTGCTGGTGCGGGAACGCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.8

Weight (kDa)

9.64

Isoelectric Point (pI)

66.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 42
AccI GTMKAC 1 cut(s) 100
AciI CCGC 1 cut(s) 289
AclI AACGTT 1 cut(s) 130
AclWI GGATC 1 cut(s) 261
AcsI RAATTY 1 cut(s) 230
AgsI TTSAA 2 cut(s) 236, 247
AloI GAACNNNNNNTCC 2 cut(s) 115, 147
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
Alw26I GTCTC 2 cut(s) 28, 118
AlwI GGATC 1 cut(s) 261
AoxI GGCC 1 cut(s) 61
ApeKI GCWGC 3 cut(s) 5, 277, 280
ApoI RAATTY 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 74
AvaII GGWCC 1 cut(s) 74
BbvI GCAGC 3 cut(s) 17, 264, 267
BccI CCATC 1 cut(s) 258
BcoDI GTCTC 2 cut(s) 28, 118
BfaI CTAG 1 cut(s) 203
BisI GCNGC 3 cut(s) 6, 278, 281
BlsI GCNGC 3 cut(s) 7, 279, 282
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 74
BsaWI WCCGGW 1 cut(s) 13
BsaXI ACNNNNNCTCC 2 cut(s) 115, 145
BseGI GGATG 2 cut(s) 269, 276
BseXI GCAGC 3 cut(s) 17, 264, 267
BshFI GGCC 1 cut(s) 63
BsiSI CCGG 1 cut(s) 14
BsmAI GTCTC 2 cut(s) 28, 118
BsnI GGCC 1 cut(s) 63
Bsp143I GATC 2 cut(s) 110, 253
BspACI CCGC 1 cut(s) 289
BspANI GGCC 1 cut(s) 63
BspPI GGATC 1 cut(s) 261
BssMI GATC 2 cut(s) 110, 253
Bst4CI ACNGT 1 cut(s) 218
BstF5I GGATG 2 cut(s) 269, 276
BstKTI GATC 2 cut(s) 113, 256
BstMAI GTCTC 2 cut(s) 28, 118
BstMBI GATC 2 cut(s) 110, 253
BstMWI GCNNNNNNNGC 1 cut(s) 286
BstV1I GCAGC 3 cut(s) 17, 264, 267
BstXI CCANNNNNNTGG 1 cut(s) 71
BsuRI GGCC 1 cut(s) 63
BtsCI GGATG 2 cut(s) 269, 276
BtsIMutI CAGTG 1 cut(s) 223
Cfr13I GGNCC 1 cut(s) 74
CviJI RGCY 3 cut(s) 63, 68, 277
CviKI_1 RGCY 3 cut(s) 63, 68, 277
DpnI GATC 2 cut(s) 112, 255
DpnII GATC 2 cut(s) 110, 253
DrdI GACNNNNNNGTC 1 cut(s) 42
DseDI GACNNNNNNGTC 1 cut(s) 42
Eco32I GATATC 1 cut(s) 208
Eco47I GGWCC 1 cut(s) 74
EcoRV GATATC 1 cut(s) 208
FaiI YATR 3 cut(s) 89, 137, 258
FauI CCCGC 1 cut(s) 282
FblI GTMKAC 1 cut(s) 100
Fnu4HI GCNGC 3 cut(s) 6, 278, 281
FokI GGATG 2 cut(s) 276, 283
Fsp4HI GCNGC 3 cut(s) 6, 278, 281
FspBI CTAG 1 cut(s) 203
GluI GCNGC 3 cut(s) 6, 278, 281
HaeIII GGCC 1 cut(s) 63
HapII CCGG 1 cut(s) 14
HincII GTYRAC 1 cut(s) 101
HindII GTYRAC 1 cut(s) 101
HindIII AAGCTT 1 cut(s) 66
HpaII CCGG 1 cut(s) 14
Hpy166II GTNNAC 1 cut(s) 101
Hpy188I TCNGA 3 cut(s) 51, 85, 229
Hpy188III TCNNGA 2 cut(s) 114, 203
Hpy8I GTNNAC 1 cut(s) 101
HpyAV CCTTC 2 cut(s) 53, 111
HpyCH4III ACNGT 1 cut(s) 218
HpyCH4IV ACGT 2 cut(s) 43, 130
HpyCH4V TGCA 2 cut(s) 139, 223
HpyF10VI GCNNNNNNNGC 1 cut(s) 286
HpySE526I ACGT 2 cut(s) 43, 130
Kzo9I GATC 2 cut(s) 110, 253
LpnPI CCDG 3 cut(s) 27, 57, 269
Lsp1109I GCAGC 3 cut(s) 17, 264, 267
MaeI CTAG 1 cut(s) 203
MaeII ACGT 2 cut(s) 43, 130
MaeIII GTNAC 1 cut(s) 212
MalI GATC 2 cut(s) 112, 255
MboI GATC 2 cut(s) 110, 253
MboII GAAGA 1 cut(s) 29
MluCI AATT 2 cut(s) 105, 230
MseI TTAA 1 cut(s) 186
MslI CAYNNNNRTG 1 cut(s) 51
MspI CCGG 1 cut(s) 14
MwoI GCNNNNNNNGC 1 cut(s) 286
NdeII GATC 2 cut(s) 110, 253
PkrI GCNGC 3 cut(s) 7, 279, 282
Psp1406I AACGTT 1 cut(s) 130
PspPI GGNCC 1 cut(s) 74
RseI CAYNNNNRTG 1 cut(s) 51
SalI GTCGAC 1 cut(s) 99
SaqAI TTAA 1 cut(s) 186
SatI GCNGC 3 cut(s) 6, 278, 281
Sau3AI GATC 2 cut(s) 110, 253
Sau96I GGNCC 1 cut(s) 74
SetI ASST 5 cut(s) 46, 70, 100, 122, 133
SgeI CNNG 8 cut(s) 26, 77, 84, 126, 187, 215, 262, 296
SinI GGWCC 1 cut(s) 74
SmiMI CAYNNNNRTG 1 cut(s) 51
Sse9I AATT 2 cut(s) 105, 230
SsiI CCGC 1 cut(s) 289
SspMI CTAG 1 cut(s) 203
TaaI ACNGT 1 cut(s) 218
TaiI ACGT 2 cut(s) 46, 133
TaqI TCGA 1 cut(s) 100
TasI AATT 2 cut(s) 105, 230
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 1 cut(s) 223
TseI GCWGC 3 cut(s) 5, 277, 280
TspRI CASTG 1 cut(s) 223
VpaK11BI GGWCC 1 cut(s) 74
XapI RAATTY 1 cut(s) 230
XbaI TCTAGA 1 cut(s) 202
XmiI GTMKAC 1 cut(s) 100
XspI CTAG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.