RchiOBHm_Chr7g0218761

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
37001553 .. 37001741
189 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19583

Sequence Viewer

Length: 189 bp
ATGGCTACTGATGGGAATGCTATTGTACCATCGACGACCGCTCCAGTGGAACCAAACCCGAGAGCGCCTGATGCTCCGCCTATAGCTCCGATTGCTGTATTTGAATTAGGACTTTCTATTTCAATTGCATATTTGTATTACAATTTGGACTTCGTATTTAAATTGGGACACTTTGTATTTCAATTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.69

Weight (kDa)

4.43

Isoelectric Point (pI)

29.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 41
AciI CCGC 2 cut(s) 39, 77
AfaI GTAC 1 cut(s) 27
AgsI TTSAA 3 cut(s) 104, 123, 182
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
Ama87I CYCGRG 1 cut(s) 58
AspLEI GCGC 1 cut(s) 67
AvaI CYCGRG 1 cut(s) 58
BccI CCATC 2 cut(s) 5, 37
BfmI CTRYAG 1 cut(s) 81
BfoI RGCGCY 1 cut(s) 68
BmeT110I CYCGRG 1 cut(s) 58
BmiI GGNNCC 1 cut(s) 51
BmsI GCATC 1 cut(s) 61
BpmI CTGGAG 1 cut(s) 27
BsaXI ACNNNNNCTCC 2 cut(s) 25, 55
Bse1I ACTGG 1 cut(s) 44
BseNI ACTGG 1 cut(s) 44
Bsh1285I CGRYCG 1 cut(s) 39
BsiEI CGRYCG 1 cut(s) 39
BsiHKCI CYCGRG 1 cut(s) 58
BslFI GGGAC 1 cut(s) 180
BsmFI GGGAC 1 cut(s) 180
BsmI GAATGC 1 cut(s) 22
BsoBI CYCGRG 1 cut(s) 58
BspACI CCGC 2 cut(s) 39, 77
BspLI GGNNCC 1 cut(s) 51
BsrBI CCGCTC 1 cut(s) 41
BsrI ACTGG 1 cut(s) 44
BstH2I RGCGCY 1 cut(s) 68
BstHHI GCGC 1 cut(s) 67
BstMCI CGRYCG 1 cut(s) 39
BstMWI GCNNNNNNNGC 2 cut(s) 71, 92
BstSFI CTRYAG 1 cut(s) 81
BtsIMutI CAGTG 1 cut(s) 51
CfoI GCGC 1 cut(s) 67
Csp6I GTAC 1 cut(s) 26
CviJI RGCY 2 cut(s) 5, 86
CviKI_1 RGCY 2 cut(s) 5, 86
CviQI GTAC 1 cut(s) 26
DraI TTTAAA 1 cut(s) 160
EciI GGCGGA 1 cut(s) 66
Eco88I CYCGRG 1 cut(s) 58
FaiI YATR 2 cut(s) 83, 130
FaqI GGGAC 1 cut(s) 180
GlaI GCGC 1 cut(s) 66
GsuI CTGGAG 1 cut(s) 27
HaeII RGCGCY 1 cut(s) 68
HhaI GCGC 1 cut(s) 67
Hin6I GCGC 1 cut(s) 65
HinP1I GCGC 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 90
Hpy99I CGWCG 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 2 cut(s) 71, 92
HspAI GCGC 1 cut(s) 65
LmnI GCTCC 3 cut(s) 46, 79, 91
LpnPI CCDG 2 cut(s) 57, 81
LweI GCATC 1 cut(s) 61
MbiI CCGCTC 1 cut(s) 41
MfeI CAATTG 2 cut(s) 123, 182
MluCI AATT 5 cut(s) 104, 123, 142, 161, 182
MseI TTAA 1 cut(s) 159
MunI CAATTG 2 cut(s) 123, 182
Mva1269I GAATGC 1 cut(s) 22
MwoI GCNNNNNNNGC 2 cut(s) 71, 92
NlaIV GGNNCC 1 cut(s) 51
PctI GAATGC 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 51
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
SaqAI TTAA 1 cut(s) 159
SetI ASST 1 cut(s) 88
SfaNI GCATC 1 cut(s) 61
SfcI CTRYAG 1 cut(s) 81
SgeI CNNG 4 cut(s) 56, 70, 72, 80
SmiI ATTTAAAT 1 cut(s) 160
Sse9I AATT 5 cut(s) 104, 123, 142, 161, 182
SsiI CCGC 2 cut(s) 39, 77
SwaI ATTTAAAT 1 cut(s) 160
TaqI TCGA 1 cut(s) 32
TasI AATT 5 cut(s) 104, 123, 142, 161, 182
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TscAI CASTG 1 cut(s) 51
TspRI CASTG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.