Rh2AG189900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0001940
Physical Location & Seq
Forward (+)
18720497 .. 18723397
2901 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG189900.1

Sequence Viewer

Length: 186 bp
ATGGCCACCGATGGGAATGCTATTGTACCATCGCCGAAAGCTCCAGCTGAACCCAACCCGGGAGCGCCTGAGGCTCCGCCTACGGCTCCAACGTCTGCTCGTCCTCCTAGACCATCAAAAAGCAAGAGAAAGCGGGCTGAAAAGAAGGCAGTGAAGCCACTGAAGGTCACAGCCAGGTTGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.35

Weight (kDa)

11.11

Isoelectric Point (pI)

61.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 77, 133
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 182
AfaI GTAC 1 cut(s) 27
AfiI CCNNNNNNNGG 2 cut(s) 12, 59
AjnI CCWGG 1 cut(s) 173
AluBI AGCT 2 cut(s) 41, 47
AluI AGCT 2 cut(s) 41, 47
Ama87I CYCGRG 1 cut(s) 58
AoxI GGCC 1 cut(s) 3
AspLEI GCGC 1 cut(s) 67
AsuC2I CCSGG 2 cut(s) 59, 60
AvaI CYCGRG 1 cut(s) 58
AxyI CCTNAGG 1 cut(s) 69
BalI TGGCCA 1 cut(s) 5
BccI CCATC 3 cut(s) 5, 37, 121
BceAI ACGGC 1 cut(s) 99
BcgI CGANNNNNNTGC 1 cut(s) 33
BciT130I CCWGG 1 cut(s) 175
BcnI CCSGG 2 cut(s) 59, 60
BfaI CTAG 1 cut(s) 108
BfoI RGCGCY 1 cut(s) 68
Bme1390I CCNGG 3 cut(s) 59, 60, 175
BmeT110I CYCGRG 1 cut(s) 58
BmiI GGNNCC 2 cut(s) 75, 87
BmrFI CCNGG 3 cut(s) 59, 60, 175
BpmI CTGGAG 1 cut(s) 27
BpuMI CCSGG 2 cut(s) 59, 60
BsaJI CCNNGG 1 cut(s) 58
Bsc4I CCNNNNNNNGG 2 cut(s) 12, 59
Bse21I CCTNAGG 1 cut(s) 69
BseBI CCWGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 58
BseLI CCNNNNNNNGG 2 cut(s) 12, 59
BseMII CTCAG 1 cut(s) 60
BshFI GGCC 1 cut(s) 5
BsiHKCI CYCGRG 1 cut(s) 58
BsiSI CCGG 1 cut(s) 59
BslI CCNNNNNNNGG 2 cut(s) 12, 59
BsmI GAATGC 1 cut(s) 22
BsnI GGCC 1 cut(s) 5
BsoBI CYCGRG 1 cut(s) 58
Bsp143I GATC 1 cut(s) 180
BspACI CCGC 2 cut(s) 77, 133
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 61
BspLI GGNNCC 2 cut(s) 75, 87
BssECI CCNNGG 1 cut(s) 58
BssMI GATC 1 cut(s) 180
Bst2UI CCWGG 1 cut(s) 175
BstC8I GCNNGC 1 cut(s) 135
BstDEI CTNAG 1 cut(s) 69
BstH2I RGCGCY 1 cut(s) 68
BstHHI GCGC 1 cut(s) 67
BstKTI GATC 1 cut(s) 183
BstMBI GATC 1 cut(s) 180
BstMWI GCNNNNNNNGC 1 cut(s) 71
BstNI CCWGG 1 cut(s) 175
BstSCI CCNGG 3 cut(s) 57, 58, 173
Bsu36I CCTNAGG 1 cut(s) 69
BsuRI GGCC 1 cut(s) 5
BtgZI GCGATG 1 cut(s) 15
BtsI GCAGTG 1 cut(s) 156
BtsIMutI CAGTG 2 cut(s) 156, 158
Cac8I GCNNGC 1 cut(s) 135
CfoI GCGC 1 cut(s) 67
Cfr9I CCCGGG 1 cut(s) 58
Csp6I GTAC 1 cut(s) 26
CviJI RGCY 8 cut(s) 5, 41, 47, 74, 86, 137, 157, 173
CviKI_1 RGCY 8 cut(s) 5, 41, 47, 74, 86, 137, 157, 173
CviQI GTAC 1 cut(s) 26
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 182
DpnII GATC 1 cut(s) 180
EaeI YGGCCR 1 cut(s) 3
EciI GGCGGA 1 cut(s) 66
Eco57I CTGAAG 1 cut(s) 182
Eco81I CCTNAGG 1 cut(s) 69
Eco88I CYCGRG 1 cut(s) 58
EcoRII CCWGG 1 cut(s) 173
FauI CCCGC 1 cut(s) 126
FspBI CTAG 1 cut(s) 108
GlaI GCGC 1 cut(s) 66
GsuI CTGGAG 1 cut(s) 27
HaeII RGCGCY 1 cut(s) 68
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 59
HhaI GCGC 1 cut(s) 67
Hin6I GCGC 1 cut(s) 65
HinP1I GCGC 1 cut(s) 65
HpaII CCGG 1 cut(s) 59
Hpy188I TCNGA 1 cut(s) 185
HpyAV CCTTC 2 cut(s) 139, 157
HpyCH4IV ACGT 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 92
HspAI GCGC 1 cut(s) 65
Kzo9I GATC 1 cut(s) 180
LmnI GCTCC 4 cut(s) 46, 62, 79, 91
LpnPI CCDG 4 cut(s) 57, 72, 81, 160
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 92
MaeIII GTNAC 1 cut(s) 166
MalI GATC 1 cut(s) 182
MboI GATC 1 cut(s) 180
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 113
MnlI CCTC 2 cut(s) 64, 114
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 47
MspI CCGG 1 cut(s) 59
MspR9I CCNGG 3 cut(s) 59, 60, 175
Mva1269I GAATGC 1 cut(s) 22
MvaI CCWGG 1 cut(s) 175
MwoI GCNNNNNNNGC 1 cut(s) 71
NciI CCSGG 2 cut(s) 59, 60
NdeII GATC 1 cut(s) 180
NlaIV GGNNCC 2 cut(s) 75, 87
NmuCI GTSAC 1 cut(s) 166
PcsI WCGNNNNNNNCGW 1 cut(s) 89
PctI GAATGC 1 cut(s) 22
Psp6I CCWGG 1 cut(s) 173
PspGI CCWGG 1 cut(s) 173
PspN4I GGNNCC 2 cut(s) 75, 87
PvuII CAGCTG 1 cut(s) 47
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
Sau3AI GATC 1 cut(s) 180
ScrFI CCNGG 3 cut(s) 59, 60, 175
SetI ASST 5 cut(s) 43, 49, 95, 168, 179
SgeI CNNG 9 cut(s) 56, 70, 71, 72, 80, 111, 120, 136, 146
SmaI CCCGGG 1 cut(s) 60
SsiI CCGC 2 cut(s) 77, 133
SspMI CTAG 1 cut(s) 108
StyD4I CCNGG 3 cut(s) 57, 58, 173
TaiI ACGT 1 cut(s) 95
TscAI CASTG 2 cut(s) 156, 165
TseFI GTSAC 1 cut(s) 166
Tsp45I GTSAC 1 cut(s) 166
TspMI CCCGGG 1 cut(s) 58
TspRI CASTG 2 cut(s) 156, 165
XmaI CCCGGG 1 cut(s) 58
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.