Rh5AG472000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
80926415 .. 80929171
2757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG472000.1

Sequence Viewer

Length: 342 bp
ATGGCCACTGATGGGAATGCTATTATACCATCGTCGACACCGCTAGTAGAACCAAACCCGAGAGTGCCTGATGCTCTGATTGCACCTACAGCTCCGACAGCTGCTCGTCCTCCAAGACCACTAAGAAGCAAGAGGAAGAGGGCTGAGAAGAAGGCTGTCAAGCCACTGAAGATCACAACCAGGTCCAATGTCTGGGAACACTTTGAGAAGTTTGATAGGCCAATAGTGGAGGTTGTGGATGGAAAGAAGCAGGAAGTTGGACGTGAAGTAAGAGCAAAGTGCAGGGACAAGTGTGGAAGCCAATTAATGGATGGCTGCATTGCTGGTGAATTGCTGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

12.47

Weight (kDa)

9.67

Isoelectric Point (pI)

36.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 192, 307
AccI GTMKAC 1 cut(s) 35
AciI CCGC 1 cut(s) 41
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 188
AfiI CCNNNNNNNGG 3 cut(s) 12, 192, 307
AjiI CACGTC 1 cut(s) 263
AjnI CCWGG 1 cut(s) 179
AluBI AGCT 2 cut(s) 92, 101
AluI AGCT 2 cut(s) 92, 101
Ama87I CYCGRG 1 cut(s) 58
AoxI GGCC 2 cut(s) 3, 218
ApeKI GCWGC 2 cut(s) 101, 315
AseI ATTAAT 1 cut(s) 305
AspS9I GGNCC 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 338
AvaI CYCGRG 1 cut(s) 58
AvaII GGWCC 1 cut(s) 183
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 2 cut(s) 88, 302
BccI CCATC 4 cut(s) 5, 37, 233, 305
BciT130I CCWGG 1 cut(s) 181
BfaI CTAG 1 cut(s) 44
BfmI CTRYAG 1 cut(s) 87
BisI GCNGC 2 cut(s) 102, 316
BlsI GCNGC 2 cut(s) 103, 317
Bme1390I CCNGG 1 cut(s) 181
Bme18I GGWCC 1 cut(s) 183
BmeT110I CYCGRG 1 cut(s) 58
BmgBI CACGTC 1 cut(s) 263
BmgT120I GGNCC 1 cut(s) 183
BmrFI CCNGG 1 cut(s) 181
BmsI GCATC 1 cut(s) 61
Bsc4I CCNNNNNNNGG 3 cut(s) 12, 192, 307
Bse3DI GCAATG 1 cut(s) 318
BseBI CCWGG 1 cut(s) 181
BseGI GGATG 2 cut(s) 244, 316
BseLI CCNNNNNNNGG 3 cut(s) 12, 192, 307
BseMI GCAATG 1 cut(s) 318
BseMII CTCAG 1 cut(s) 135
BseXI GCAGC 2 cut(s) 88, 302
BsgI GTGCAG 1 cut(s) 301
BshFI GGCC 2 cut(s) 5, 220
BsiHKCI CYCGRG 1 cut(s) 58
BslFI GGGAC 1 cut(s) 299
BslI CCNNNNNNNGG 3 cut(s) 12, 192, 307
BsmFI GGGAC 1 cut(s) 299
BsmI GAATGC 1 cut(s) 22
BsnI GGCC 2 cut(s) 5, 220
BsoBI CYCGRG 1 cut(s) 58
Bsp143I GATC 1 cut(s) 171
BspACI CCGC 1 cut(s) 41
BspANI GGCC 2 cut(s) 5, 220
BspCNI CTCAG 1 cut(s) 136
BsrDI GCAATG 1 cut(s) 318
BssMI GATC 1 cut(s) 171
Bst2UI CCWGG 1 cut(s) 181
Bst6I CTCTTC 1 cut(s) 131
BstDEI CTNAG 2 cut(s) 122, 144
BstF5I GGATG 2 cut(s) 244, 316
BstKTI GATC 1 cut(s) 174
BstMBI GATC 1 cut(s) 171
BstMWI GCNNNNNNNGC 3 cut(s) 80, 89, 98
BstNI CCWGG 1 cut(s) 181
BstSCI CCNGG 1 cut(s) 179
BstSFI CTRYAG 1 cut(s) 87
BstV1I GCAGC 2 cut(s) 88, 302
BsuRI GGCC 2 cut(s) 5, 220
BtrI CACGTC 1 cut(s) 263
BtsCI GGATG 2 cut(s) 244, 316
BtsIMutI CAGTG 2 cut(s) 6, 164
Cfr13I GGNCC 1 cut(s) 183
CsiI ACCWGGT 1 cut(s) 179
CviJI RGCY 9 cut(s) 5, 92, 101, 143, 155, 163, 220, 300, 315
CviKI_1 RGCY 9 cut(s) 5, 92, 101, 143, 155, 163, 220, 300, 315
DdeI CTNAG 2 cut(s) 122, 144
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco47I GGWCC 1 cut(s) 183
Eco57I CTGAAG 1 cut(s) 188
Eco88I CYCGRG 1 cut(s) 58
EcoRII CCWGG 1 cut(s) 179
FaiI YATR 1 cut(s) 26
FaqI GGGAC 1 cut(s) 299
FblI GTMKAC 1 cut(s) 35
Fnu4HI GCNGC 2 cut(s) 102, 316
FokI GGATG 2 cut(s) 251, 323
Fsp4HI GCNGC 2 cut(s) 102, 316
FspBI CTAG 1 cut(s) 44
GluI GCNGC 2 cut(s) 102, 316
HaeIII GGCC 2 cut(s) 5, 220
HincII GTYRAC 1 cut(s) 36
HindII GTYRAC 1 cut(s) 36
HphI GGTGA 1 cut(s) 338
Hpy166II GTNNAC 1 cut(s) 36
Hpy188I TCNGA 2 cut(s) 78, 96
Hpy8I GTNNAC 1 cut(s) 36
Hpy99I CGWCG 1 cut(s) 37
HpyAV CCTTC 1 cut(s) 145
HpyCH4IV ACGT 1 cut(s) 262
HpyCH4V TGCA 3 cut(s) 83, 282, 318
HpyF10VI GCNNNNNNNGC 3 cut(s) 80, 89, 98
HpyF3I CTNAG 2 cut(s) 122, 144
HpySE526I ACGT 1 cut(s) 262
Kzo9I GATC 1 cut(s) 171
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 8 cut(s) 81, 166, 178, 193, 236, 268, 309, 320
Lsp1109I GCAGC 2 cut(s) 88, 302
LweI GCATC 1 cut(s) 61
MabI ACCWGGT 1 cut(s) 179
MaeI CTAG 1 cut(s) 44
MaeII ACGT 1 cut(s) 262
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MboII GAAGA 3 cut(s) 148, 160, 181
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 302, 329
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 2 cut(s) 119, 238
MnlI CCTC 4 cut(s) 120, 126, 132, 223
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 305
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 101
MspR9I CCNGG 1 cut(s) 181
Mva1269I GAATGC 1 cut(s) 22
MvaI CCWGG 1 cut(s) 181
MwoI GCNNNNNNNGC 3 cut(s) 80, 89, 98
NdeII GATC 1 cut(s) 171
PctI GAATGC 1 cut(s) 22
PflMI CCANNNNNTGG 2 cut(s) 192, 307
PkrI GCNGC 2 cut(s) 103, 317
PshBI ATTAAT 1 cut(s) 305
Psp6I CCWGG 1 cut(s) 179
PspGI CCWGG 1 cut(s) 179
PspPI GGNCC 1 cut(s) 183
PvuII CAGCTG 1 cut(s) 101
SalI GTCGAC 1 cut(s) 34
SaqAI TTAA 1 cut(s) 305
SatI GCNGC 2 cut(s) 102, 316
Sau3AI GATC 1 cut(s) 171
Sau96I GGNCC 1 cut(s) 183
ScrFI CCNGG 1 cut(s) 181
SetI ASST 6 cut(s) 88, 94, 103, 185, 234, 265
SexAI ACCWGGT 1 cut(s) 179
SfaNI GCATC 1 cut(s) 61
SfcI CTRYAG 1 cut(s) 87
SinI GGWCC 1 cut(s) 183
Sse9I AATT 2 cut(s) 302, 329
SsiI CCGC 1 cut(s) 41
SspMI CTAG 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 179
TaiI ACGT 1 cut(s) 265
TaqI TCGA 1 cut(s) 35
TasI AATT 2 cut(s) 302, 329
Tru1I TTAA 1 cut(s) 305
Tru9I TTAA 1 cut(s) 305
TscAI CASTG 2 cut(s) 13, 171
TseI GCWGC 2 cut(s) 101, 315
TspRI CASTG 2 cut(s) 13, 171
Van91I CCANNNNNTGG 2 cut(s) 192, 307
VpaK11BI GGWCC 1 cut(s) 183
VspI ATTAAT 1 cut(s) 305
XcmI CCANNNNNNNNNTGG 1 cut(s) 308
XmiI GTMKAC 1 cut(s) 35
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.