Rmu_co8042740.1_g000001

UDP-galactose transporter 2-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8042740.1
Physical Location & Seq
Forward (+)
1 .. 271
271 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8042740.1_g000001.1.cds

Sequence Viewer

Length: 213 bp
atttccaagttgagcatgattcctgtggtttgtgtgatggaatggattcttaacaacaagcagtattccaaggaggttaaagtggctgttgtggttgtggttataggtgttggtgtttgtactgtgactgatgtgaaagttaacctcaaaggcttcatatgcgcctgcctagcagttttgtccacttctttccagcaaattgtgagtgtttag

Protein Analysis

70

Amino Acids

7.54

Weight (kDa)

8.83

Isoelectric Point (pI)

23.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 121
Asp700I GAANNNNTTC 1 cut(s) 45
AspLEI GCGC 1 cut(s) 164
BccI CCATC 1 cut(s) 31
BfaI CTAG 1 cut(s) 170
BsaJI CCNNGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 69
BssECI CCNNGG 1 cut(s) 69
BssT1I CCWWGG 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 124
BstC8I GCNNGC 1 cut(s) 166
BstHHI GCGC 1 cut(s) 164
BstMWI GCNNNNNNNGC 2 cut(s) 159, 170
Cac8I GCNNGC 1 cut(s) 166
CfoI GCGC 1 cut(s) 164
Csp6I GTAC 1 cut(s) 120
CviAII CATG 1 cut(s) 16
CviJI RGCY 2 cut(s) 86, 153
CviKI_1 RGCY 2 cut(s) 86, 153
CviQI GTAC 1 cut(s) 120
Eco130I CCWWGG 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
FaeI CATG 1 cut(s) 19
FaiI YATR 4 cut(s) 17, 104, 158, 160
FatI CATG 1 cut(s) 15
FauNDI CATATG 1 cut(s) 158
FspBI CTAG 1 cut(s) 170
GlaI GCGC 1 cut(s) 163
HhaI GCGC 1 cut(s) 164
Hin1II CATG 1 cut(s) 19
Hin6I GCGC 1 cut(s) 162
HinP1I GCGC 1 cut(s) 162
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HinfI GANTC 2 cut(s) 19, 46
HpaI GTTAAC 1 cut(s) 142
Hpy166II GTNNAC 2 cut(s) 142, 183
Hpy8I GTNNAC 2 cut(s) 142, 183
HpyCH4III ACNGT 1 cut(s) 124
HpyF10VI GCNNNNNNNGC 2 cut(s) 159, 170
Hsp92II CATG 1 cut(s) 19
HspAI GCGC 1 cut(s) 162
KspAI GTTAAC 1 cut(s) 142
LpnPI CCDG 3 cut(s) 36, 178, 206
MaeI CTAG 1 cut(s) 170
MaeIII GTNAC 1 cut(s) 124
MluCI AATT 1 cut(s) 198
MnlI CCTC 2 cut(s) 67, 155
MroXI GAANNNNTTC 1 cut(s) 45
MseI TTAA 3 cut(s) 51, 78, 141
MwoI GCNNNNNNNGC 2 cut(s) 159, 170
NdeI CATATG 1 cut(s) 158
NlaIII CATG 1 cut(s) 19
NmuCI GTSAC 1 cut(s) 124
PdmI GAANNNNTTC 1 cut(s) 45
PfeI GAWTC 2 cut(s) 19, 46
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SaqAI TTAA 3 cut(s) 51, 78, 141
SetI ASST 3 cut(s) 78, 109, 147
SgeI CNNG 8 cut(s) 19, 28, 35, 70, 82, 177, 182, 205
Sse9I AATT 1 cut(s) 198
SspMI CTAG 1 cut(s) 170
StyI CCWWGG 1 cut(s) 69
TaaI ACNGT 1 cut(s) 124
TasI AATT 1 cut(s) 198
TatI WGTACW 1 cut(s) 119
TfiI GAWTC 2 cut(s) 19, 46
Tru1I TTAA 3 cut(s) 51, 78, 141
Tru9I TTAA 3 cut(s) 51, 78, 141
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 145
XmnI GAANNNNTTC 1 cut(s) 45
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.