Rorug07G0171900

UDP-galactose transporter 2-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
13996257 .. 13996627
371 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0171900.1

Sequence Viewer

Length: 174 bp
ATGGTGGCCATGCCTTTTCACGACGGCAACATCCACGACTTGATTGAGATTCGATACCTCGACGTTCGCCAAGATGTTAATCACAGCTTGCAGATGCACTCATCATTGGTACAACGGCTTTCTCACAGAGTTGGAGGTTTGCTTCAACTTCACAGCTTCTTATTTGCTAAATGA

Protein Analysis

57

Amino Acids

6.62

Weight (kDa)

7.02

Isoelectric Point (pI)

71.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 6
AfaI GTAC 1 cut(s) 111
AgsI TTSAA 1 cut(s) 146
AluBI AGCT 2 cut(s) 87, 156
AluI AGCT 2 cut(s) 87, 156
AoxI GGCC 1 cut(s) 6
BalI TGGCCA 1 cut(s) 8
BceAI ACGGC 2 cut(s) 40, 131
BmsI GCATC 1 cut(s) 84
BsaBI GATNNNNATC 1 cut(s) 78
Bse8I GATNNNNATC 1 cut(s) 78
BseGI GGATG 1 cut(s) 30
BseJI GATNNNNATC 1 cut(s) 78
BshFI GGCC 1 cut(s) 8
BsnI GGCC 1 cut(s) 8
BspANI GGCC 1 cut(s) 8
BstC8I GCNNGC 1 cut(s) 89
BstF5I GGATG 1 cut(s) 30
BsuRI GGCC 1 cut(s) 8
BtsCI GGATG 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 89
Csp6I GTAC 1 cut(s) 110
CviAII CATG 1 cut(s) 10
CviJI RGCY 4 cut(s) 8, 87, 118, 156
CviKI_1 RGCY 4 cut(s) 8, 87, 118, 156
CviQI GTAC 1 cut(s) 110
EaeI YGGCCR 1 cut(s) 6
FaeI CATG 1 cut(s) 13
FaiI YATR 1 cut(s) 11
FatI CATG 1 cut(s) 9
FokI GGATG 1 cut(s) 17
HaeIII GGCC 1 cut(s) 8
Hin1II CATG 1 cut(s) 13
HinfI GANTC 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 20
Hpy99I CGWCG 2 cut(s) 26, 65
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 2 cut(s) 91, 97
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 1 cut(s) 13
LweI GCATC 1 cut(s) 84
MaeII ACGT 1 cut(s) 63
MlsI TGGCCA 1 cut(s) 8
MluNI TGGCCA 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 112
MnlI CCTC 2 cut(s) 68, 128
Mox20I TGGCCA 1 cut(s) 8
MscI TGGCCA 1 cut(s) 8
MseI TTAA 1 cut(s) 78
Msp20I TGGCCA 1 cut(s) 8
NlaIII CATG 1 cut(s) 13
PfeI GAWTC 1 cut(s) 49
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 78
SetI ASST 5 cut(s) 60, 66, 89, 139, 158
SfaNI GCATC 1 cut(s) 84
SgeI CNNG 7 cut(s) 22, 32, 47, 52, 71, 83, 100
TaiI ACGT 1 cut(s) 66
TaqI TCGA 2 cut(s) 52, 60
TfiI GAWTC 1 cut(s) 49
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.