Rmu_co8237817.1_g000001

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8237817.1
Physical Location & Seq
Reverse (-)
1 .. 731
731 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8237817.1_g000001.1.cds

Sequence Viewer

Length: 724 bp
atgctcggcccacaccgagaaatcaaagatggtctcgaagtttcaggtttagagccaataccaaaagcatggattcctccaccacttctcaaggacggcaacaatctcctgaagagctttttcacagagaatggcaagaaaatgacggagtcgactggaattctgatcaacacattcgagagtatagaacatgagacagtggctgcactaaatgagggcagggtattaaaagggctaccatcggcaattgccattggaccacttccaccatgtaactctgagacagaccatcaactagcatggctagatgatcaaccaactggatcagtgttctatgtcagctttgggagtaggactgcaatgtcaaggaagcaaatcagagagttgggtgagggcttggtgaggagtgggtgtaggtttctgtgggtcgtgaaggataaaaaagttgacatggaagacgatgagaaactgactgaggtgcttggacagggtttactggaaagagtgaaggaaaagggattggcagtgaagaagtggctgaaccaagaggaggtattgaggcatcctgcaatcgctggctttttaagtcattgtggctggaattccttgagtgaggctctgtggaacggtgtggccgtattagcatggccgcaacatggggaccagaaaatcaatgccgacttggtggagagaattgggctgggagtgtgggttaagagttggg

Protein Analysis

241

Amino Acids

26.75

Weight (kDa)

5.91

Isoelectric Point (pI)

34.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 361
AccI GTMKAC 1 cut(s) 152
AciI CCGC 1 cut(s) 650
AclWI GGATC 1 cut(s) 331
AcoI YGGCCR 2 cut(s) 633, 647
AcsI RAATTY 2 cut(s) 159, 601
AcuI CTGAAG 1 cut(s) 131
AfiI CCNNNNNNNGG 2 cut(s) 550, 656
AluBI AGCT 2 cut(s) 117, 342
AluI AGCT 2 cut(s) 117, 342
Alw26I GTCTC 3 cut(s) 38, 188, 275
AlwI GGATC 1 cut(s) 331
AlwNI CAGNNNCTG 1 cut(s) 203
AoxI GGCC 3 cut(s) 7, 633, 647
ApeKI GCWGC 1 cut(s) 203
ApoI RAATTY 2 cut(s) 159, 601
AspS9I GGNCC 3 cut(s) 8, 257, 661
AsuHPI GGTGA 2 cut(s) 401, 412
AvaII GGWCC 2 cut(s) 257, 661
BbsI GAAGAC 1 cut(s) 462
BbvI GCAGC 1 cut(s) 190
BccI CCATC 3 cut(s) 23, 247, 297
BceAI ACGGC 2 cut(s) 112, 620
BclI TGATCA 2 cut(s) 165, 310
BcoDI GTCTC 3 cut(s) 38, 188, 275
BfaI CTAG 2 cut(s) 296, 305
BisI GCNGC 2 cut(s) 204, 650
BlsI GCNGC 2 cut(s) 205, 651
Bme18I GGWCC 2 cut(s) 257, 661
BmgT120I GGNCC 3 cut(s) 8, 257, 661
BmiI GGNNCC 1 cut(s) 662
BmsI GCATC 1 cut(s) 571
BpiI GAAGAC 1 cut(s) 462
BplI GAGNNNNNCTC 2 cut(s) 601, 633
BpuEI CTTGAG 2 cut(s) 74, 628
BsaI GGTCTC 1 cut(s) 38
BsaXI ACNNNNNCTCC 3 cut(s) 397, 427, 696
Bsc4I CCNNNNNNNGG 2 cut(s) 550, 656
Bse1I ACTGG 3 cut(s) 160, 325, 501
Bse3DI GCAATG 1 cut(s) 366
BseGI GGATG 1 cut(s) 562
BseLI CCNNNNNNNGG 2 cut(s) 550, 656
BseMI GCAATG 1 cut(s) 366
BseMII CTCAG 2 cut(s) 270, 465
BseNI ACTGG 3 cut(s) 160, 325, 501
BseRI GAGGAG 2 cut(s) 418, 563
BseXI GCAGC 1 cut(s) 190
BseYI CCCAGC 1 cut(s) 700
BsgI GTGCAG 1 cut(s) 189
BshFI GGCC 3 cut(s) 9, 635, 649
BslFI GGGAC 1 cut(s) 674
BslI CCNNNNNNNGG 2 cut(s) 550, 656
BsmAI GTCTC 3 cut(s) 38, 188, 275
BsmFI GGGAC 1 cut(s) 674
BsnI GGCC 3 cut(s) 9, 635, 649
Bso31I GGTCTC 1 cut(s) 38
Bsp143I GATC 3 cut(s) 165, 310, 323
BspACI CCGC 1 cut(s) 650
BspANI GGCC 3 cut(s) 9, 635, 649
BspCNI CTCAG 2 cut(s) 271, 466
BspLI GGNNCC 1 cut(s) 662
BspPI GGATC 1 cut(s) 331
BspQI GCTCTTC 1 cut(s) 107
BspTNI GGTCTC 1 cut(s) 38
BsrDI GCAATG 1 cut(s) 366
BsrI ACTGG 3 cut(s) 160, 325, 501
BssMI GATC 3 cut(s) 165, 310, 323
Bst4CI ACNGT 2 cut(s) 199, 629
Bst6I CTCTTC 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 577
BstDEI CTNAG 2 cut(s) 279, 474
BstF5I GGATG 1 cut(s) 562
BstKTI GATC 3 cut(s) 168, 313, 326
BstMAI GTCTC 3 cut(s) 38, 188, 275
BstMBI GATC 3 cut(s) 165, 310, 323
BstMWI GCNNNNNNNGC 1 cut(s) 641
BstV1I GCAGC 1 cut(s) 190
BstV2I GAAGAC 1 cut(s) 462
BstXI CCANNNNNNTGG 1 cut(s) 69
BsuRI GGCC 3 cut(s) 9, 635, 649
BtsCI GGATG 1 cut(s) 562
BtsI GCAGTG 1 cut(s) 531
BtsIMutI CAGTG 3 cut(s) 204, 333, 531
Cac8I GCNNGC 1 cut(s) 577
CaiI CAGNNNCTG 1 cut(s) 203
Cfr13I GGNCC 3 cut(s) 8, 257, 661
CviAII CATG 7 cut(s) 69, 191, 270, 300, 451, 645, 656
DdeI CTNAG 2 cut(s) 279, 474
DpnI GATC 3 cut(s) 167, 312, 325
DpnII GATC 3 cut(s) 165, 310, 323
DrdI GACNNNNNNGTC 1 cut(s) 361
DseDI GACNNNNNNGTC 1 cut(s) 361
EaeI YGGCCR 2 cut(s) 633, 647
Eam1104I CTCTTC 1 cut(s) 107
EarI CTCTTC 1 cut(s) 107
Eco31I GGTCTC 1 cut(s) 38
Eco47I GGWCC 2 cut(s) 257, 661
Eco57I CTGAAG 1 cut(s) 131
EcoRI GAATTC 2 cut(s) 159, 601
FaeI CATG 7 cut(s) 72, 194, 273, 303, 454, 648, 659
FaiI YATR 9 cut(s) 70, 185, 192, 271, 301, 336, 452, 646, 657
FaqI GGGAC 1 cut(s) 674
FatI CATG 7 cut(s) 68, 190, 269, 299, 450, 644, 655
FbaI TGATCA 2 cut(s) 165, 310
FblI GTMKAC 1 cut(s) 152
Fnu4HI GCNGC 2 cut(s) 204, 650
FokI GGATG 1 cut(s) 549
Fsp4HI GCNGC 2 cut(s) 204, 650
FspBI CTAG 2 cut(s) 296, 305
GluI GCNGC 2 cut(s) 204, 650
GsaI CCCAGC 1 cut(s) 704
HaeIII GGCC 3 cut(s) 9, 635, 649
Hin1II CATG 7 cut(s) 72, 194, 273, 303, 454, 648, 659
HincII GTYRAC 2 cut(s) 153, 448
HindII GTYRAC 2 cut(s) 153, 448
HinfI GANTC 2 cut(s) 73, 149
HphI GGTGA 2 cut(s) 401, 412
Hpy166II GTNNAC 3 cut(s) 153, 448, 494
Hpy188I TCNGA 3 cut(s) 165, 280, 380
Hpy188III TCNNGA 4 cut(s) 35, 109, 178, 430
Hpy8I GTNNAC 3 cut(s) 153, 448, 494
HpyAV CCTTC 2 cut(s) 427, 502
HpyCH4III ACNGT 2 cut(s) 199, 629
HpyCH4V TGCA 3 cut(s) 206, 359, 569
HpyF10VI GCNNNNNNNGC 1 cut(s) 641
HpyF3I CTNAG 2 cut(s) 279, 474
Hsp92II CATG 7 cut(s) 72, 194, 273, 303, 454, 648, 659
Ksp22I TGATCA 2 cut(s) 165, 310
Kzo9I GATC 3 cut(s) 165, 310, 323
LguI GCTCTTC 1 cut(s) 107
Lsp1109I GCAGC 1 cut(s) 190
LweI GCATC 1 cut(s) 571
MaeI CTAG 2 cut(s) 296, 305
MaeIII GTNAC 1 cut(s) 272
MalI GATC 3 cut(s) 167, 312, 325
MboI GATC 3 cut(s) 165, 310, 323
MboII GAAGA 3 cut(s) 124, 467, 541
MfeI CAATTG 1 cut(s) 246
MluCI AATT 4 cut(s) 159, 246, 601, 693
MlyI GAGTC 1 cut(s) 158
MnlI CCTC 9 cut(s) 87, 208, 385, 396, 469, 541, 544, 552, 607
MseI TTAA 3 cut(s) 227, 584, 714
MunI CAATTG 1 cut(s) 246
MwoI GCNNNNNNNGC 1 cut(s) 641
NdeII GATC 3 cut(s) 165, 310, 323
NlaIII CATG 7 cut(s) 72, 194, 273, 303, 454, 648, 659
NlaIV GGNNCC 1 cut(s) 662
PciSI GCTCTTC 1 cut(s) 107
PcsI WCGNNNNNNNCGW 1 cut(s) 633
PfeI GAWTC 1 cut(s) 73
PflFI GACNNNGTC 1 cut(s) 148
PkrI GCNGC 2 cut(s) 205, 651
PleI GAGTC 1 cut(s) 157
PpsI GAGTC 1 cut(s) 157
PspFI CCCAGC 1 cut(s) 700
PspN4I GGNNCC 1 cut(s) 662
PspPI GGNCC 3 cut(s) 8, 257, 661
PstNI CAGNNNCTG 1 cut(s) 203
PsyI GACNNNGTC 1 cut(s) 148
SalI GTCGAC 1 cut(s) 151
SapI GCTCTTC 1 cut(s) 107
SaqAI TTAA 3 cut(s) 227, 584, 714
SatI GCNGC 2 cut(s) 204, 650
Sau3AI GATC 3 cut(s) 165, 310, 323
Sau96I GGNCC 3 cut(s) 8, 257, 661
SchI GAGTC 1 cut(s) 158
SetI ASST 6 cut(s) 49, 119, 344, 419, 480, 555
SfaNI GCATC 1 cut(s) 571
SinI GGWCC 2 cut(s) 257, 661
SmlI CTYRAG 2 cut(s) 89, 607
SmoI CTYRAG 2 cut(s) 89, 607
Sse9I AATT 4 cut(s) 159, 246, 601, 693
SsiI CCGC 1 cut(s) 650
SspMI CTAG 2 cut(s) 296, 305
TaaI ACNGT 2 cut(s) 199, 629
TaqI TCGA 3 cut(s) 36, 152, 177
TasI AATT 4 cut(s) 159, 246, 601, 693
TauI GCSGC 1 cut(s) 652
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 3 cut(s) 227, 584, 714
Tru9I TTAA 3 cut(s) 227, 584, 714
TscAI CASTG 3 cut(s) 204, 333, 531
TseI GCWGC 1 cut(s) 203
TspGWI ACGGA 1 cut(s) 161
TspRI CASTG 3 cut(s) 204, 333, 531
Tth111I GACNNNGTC 1 cut(s) 148
VpaK11BI GGWCC 2 cut(s) 257, 661
XapI RAATTY 2 cut(s) 159, 601
XmiI GTMKAC 1 cut(s) 152
XspI CTAG 2 cut(s) 296, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.