Rmu_sc0023543.1_g000001

Asparagine synthetase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023543.1
Physical Location & Seq
Reverse (-)
1 .. 287
287 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023543.1_g000001.1.cds

Sequence Viewer

Length: 165 bp
atgacccttgtatttttaccggacaggttgaagcaccggggtccagattggagtggtctgtatcagcacggtgattgtttcttggcccatcagaggttggcaattattgatcctgcttctggagatcaacctctgtttaatgaagacaaatctattgttgtcacg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.22

Weight (kDa)

5.75

Isoelectric Point (pI)

8.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 104
AfiI CCNNNNNNNGG 2 cut(s) 93, 119
AgsI TTSAA 1 cut(s) 31
AlwI GGATC 1 cut(s) 104
AoxI GGCC 1 cut(s) 84
AspS9I GGNCC 2 cut(s) 41, 85
AsuC2I CCSGG 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 83
AvaII GGWCC 1 cut(s) 41
BbsI GAAGAC 1 cut(s) 150
BccI CCATC 1 cut(s) 96
BcnI CCSGG 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 38
Bme18I GGWCC 1 cut(s) 41
BmgT120I GGNCC 2 cut(s) 41, 85
BmiI GGNNCC 1 cut(s) 42
BmrFI CCNGG 1 cut(s) 38
BpiI GAAGAC 1 cut(s) 150
BpmI CTGGAG 1 cut(s) 141
BpuMI CCSGG 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 37
BsaWI WCCGGW 1 cut(s) 19
Bsc4I CCNNNNNNNGG 2 cut(s) 93, 119
BseDI CCNNGG 1 cut(s) 37
BseLI CCNNNNNNNGG 2 cut(s) 93, 119
BshFI GGCC 1 cut(s) 86
BsiSI CCGG 2 cut(s) 20, 37
BslI CCNNNNNNNGG 2 cut(s) 93, 119
BsnI GGCC 1 cut(s) 86
Bsp143I GATC 2 cut(s) 109, 124
BspANI GGCC 1 cut(s) 86
BspLI GGNNCC 1 cut(s) 42
BspPI GGATC 1 cut(s) 104
BssECI CCNNGG 1 cut(s) 37
BssMI GATC 2 cut(s) 109, 124
Bst4CI ACNGT 1 cut(s) 71
BstKTI GATC 2 cut(s) 112, 127
BstMBI GATC 2 cut(s) 109, 124
BstSCI CCNGG 1 cut(s) 36
BstV2I GAAGAC 1 cut(s) 150
BsuRI GGCC 1 cut(s) 86
Cfr13I GGNCC 2 cut(s) 41, 85
CviJI RGCY 1 cut(s) 86
CviKI_1 RGCY 1 cut(s) 86
DpnI GATC 2 cut(s) 111, 126
DpnII GATC 2 cut(s) 109, 124
Eco47I GGWCC 1 cut(s) 41
GsuI CTGGAG 1 cut(s) 141
HaeIII GGCC 1 cut(s) 86
HapII CCGG 2 cut(s) 20, 37
HpaII CCGG 2 cut(s) 20, 37
HphI GGTGA 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 2 cut(s) 44, 120
HpyCH4III ACNGT 1 cut(s) 71
Kzo9I GATC 2 cut(s) 109, 124
LpnPI CCDG 6 cut(s) 10, 33, 50, 57, 105, 126
MaeIII GTNAC 1 cut(s) 160
MalI GATC 2 cut(s) 111, 126
MboI GATC 2 cut(s) 109, 124
MboII GAAGA 1 cut(s) 155
MluCI AATT 1 cut(s) 102
MnlI CCTC 2 cut(s) 87, 141
MseI TTAA 1 cut(s) 138
MspI CCGG 2 cut(s) 20, 37
MspR9I CCNGG 1 cut(s) 38
NciI CCSGG 1 cut(s) 38
NdeII GATC 2 cut(s) 109, 124
NlaIV GGNNCC 1 cut(s) 42
NmuCI GTSAC 1 cut(s) 160
PspN4I GGNNCC 1 cut(s) 42
PspPI GGNCC 2 cut(s) 41, 85
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 2 cut(s) 109, 124
Sau96I GGNCC 2 cut(s) 41, 85
ScrFI CCNGG 1 cut(s) 38
SetI ASST 3 cut(s) 29, 98, 133
SinI GGWCC 1 cut(s) 41
Sse9I AATT 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 71
TasI AATT 1 cut(s) 102
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TseFI GTSAC 1 cut(s) 160
Tsp45I GTSAC 1 cut(s) 160
TspDTI ATGAA 1 cut(s) 156
VpaK11BI GGWCC 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.