Rmu_co8316237.1_g000001

carboxylesterase 15

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8316237.1
OG0000918
Physical Location & Seq
Forward (+)
110 .. 934
825 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8316237.1_g000001.1.cds

Sequence Viewer

Length: 825 bp
atggtccaagaaaagaaggtgatcgatgaggtttccggttggcttaggctctttgacgacggatcagtcgaccggacatggacgggaccccctgaggtcaagttcatgacagagccagtcccaccgcacattgagttcatcgacggagttgcgacaaaagacatggtcatcgatgaaacgtccggccttcgagttcgaatttacttacctgagagaaagccggaggattgtgagagtctgcccatatttctccacttccatggaggcggcttttgcattagccaagcagattggtacatgtactaccacatgtacacaaacctcgcacgtgcagccaacgccatatgcgtctccgtctatctacgcctcgcaccggagcaccgtctcccggctccgatcgacgatggcttctctgctctcctctggctccggtccctggcccgaggtgattcatatgaaccatggttcaacgaccatgcagactttaaccgtgtttacctcctgggggatagcacaggaggaaacatagtccatgaagtggctgcaagagcagggaagctggatttgagtccggcgaaattatccggcgggattcttattcaccctggttttgtccggtcatctaggagcaggtcagagctggaacagccacagtcacctatgcttactctagacatggtggacaagttcctgagctttgcactgccggtggggtccaccaaggaccatccagttacgtgtccgatgggttccggcgcaccatcgttggaaagtctgcagctgccgcggttccttgtgtgcgtggcagagagagacatcatggtg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0009056 GO:0016787
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

275

Amino Acids

30.71

Weight (kDa)

5.35

Isoelectric Point (pI)

54.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 65
Acc36I ACCTGC 1 cut(s) 621
AccB7I CCANNNNNTGG 1 cut(s) 538
AccI GTMKAC 1 cut(s) 69
AccII CGCG 1 cut(s) 787
AciI CCGC 5 cut(s) 125, 267, 588, 785, 787
AclWI GGATC 1 cut(s) 70
AcsI RAATTY 1 cut(s) 198
AcvI CACGTG 1 cut(s) 329
AfaI GTAC 3 cut(s) 296, 302, 314
AfiI CCNNNNNNNGG 5 cut(s) 373, 388, 436, 505, 538
AflIII ACRYGT 3 cut(s) 297, 309, 737
AgsI TTSAA 1 cut(s) 469
AjnI CCWGG 3 cut(s) 435, 501, 604
AluBI AGCT 4 cut(s) 559, 640, 696, 781
AluI AGCT 4 cut(s) 559, 640, 696, 781
Alw21I GWGCWC 1 cut(s) 381
Alw26I GTCTC 3 cut(s) 355, 389, 807
AlwI GGATC 1 cut(s) 70
Ama87I CYCGRG 1 cut(s) 441
AoxI GGCC 2 cut(s) 184, 438
ApeKI GCWGC 4 cut(s) 332, 542, 778, 781
ApoI RAATTY 1 cut(s) 198
AspLEI GCGC 1 cut(s) 758
AspS9I GGNCC 6 cut(s) 4, 86, 432, 439, 714, 724
AsuC2I CCSGG 1 cut(s) 389
AsuHPI GGTGA 4 cut(s) 31, 458, 593, 648
AsuII TTCGAA 1 cut(s) 196
AvaI CYCGRG 1 cut(s) 441
AvaII GGWCC 5 cut(s) 4, 86, 432, 714, 724
AxyI CCTNAGG 1 cut(s) 93
BbrPI CACGTG 1 cut(s) 329
Bbv12I GWGCWC 1 cut(s) 381
BbvI GCAGC 4 cut(s) 344, 529, 768, 790
BccI CCATC 4 cut(s) 398, 735, 739, 769
BcgI CGANNNNNNTGC 2 cut(s) 131, 165
BciT130I CCWGG 3 cut(s) 437, 503, 606
BcnI CCSGG 1 cut(s) 389
BcoDI GTCTC 3 cut(s) 355, 389, 807
BfaI CTAG 2 cut(s) 624, 671
BfmI CTRYAG 1 cut(s) 776
BfuAI ACCTGC 1 cut(s) 621
BisI GCNGC 6 cut(s) 268, 333, 543, 779, 782, 785
BlsI GCNGC 6 cut(s) 269, 334, 544, 780, 783, 786
Bme1390I CCNGG 4 cut(s) 389, 437, 503, 606
Bme18I GGWCC 5 cut(s) 4, 86, 432, 714, 724
BmeT110I CYCGRG 1 cut(s) 441
BmgT120I GGNCC 6 cut(s) 4, 86, 432, 439, 714, 724
BmiI GGNNCC 8 cut(s) 87, 88, 393, 428, 434, 715, 751, 791
BmrFI CCNGG 4 cut(s) 389, 437, 503, 606
Bpu10I CCTNAGC 2 cut(s) 44, 692
Bpu14I TTCGAA 1 cut(s) 196
BpuMI CCSGG 1 cut(s) 389
Bsa29I ATCGAT 2 cut(s) 24, 171
BsaAI YACGTR 2 cut(s) 329, 738
BsaJI CCNNGG 8 cut(s) 259, 435, 442, 461, 502, 604, 720, 785
BsaWI WCCGGW 5 cut(s) 35, 72, 373, 429, 615
Bsc4I CCNNNNNNNGG 5 cut(s) 373, 388, 436, 505, 538
Bse118I RCCGGY 1 cut(s) 706
Bse1I ACTGG 2 cut(s) 116, 731
Bse21I CCTNAGG 1 cut(s) 93
BseBI CCWGG 3 cut(s) 437, 503, 606
BseCI ATCGAT 2 cut(s) 24, 171
BseDI CCNNGG 8 cut(s) 259, 435, 442, 461, 502, 604, 720, 785
BseGI GGATG 1 cut(s) 727
BseLI CCNNNNNNNGG 5 cut(s) 373, 388, 436, 505, 538
BseMII CTCAG 3 cut(s) 84, 201, 683
BseNI ACTGG 2 cut(s) 116, 731
BseRI GAGGAG 1 cut(s) 410
BseXI GCAGC 4 cut(s) 344, 529, 768, 790
BsgI GTGCAG 1 cut(s) 351
Bsh1236I CGCG 1 cut(s) 787
Bsh1285I CGRYCG 2 cut(s) 73, 399
BshFI GGCC 2 cut(s) 186, 440
BshVI ATCGAT 2 cut(s) 24, 171
BsiEI CGRYCG 2 cut(s) 73, 399
BsiHKAI GWGCWC 1 cut(s) 381
BsiHKCI CYCGRG 1 cut(s) 441
BslFI GGGAC 3 cut(s) 99, 104, 418
BslI CCNNNNNNNGG 5 cut(s) 373, 388, 436, 505, 538
BsmAI GTCTC 3 cut(s) 355, 389, 807
BsmBI CGTCTC 2 cut(s) 355, 389
BsmFI GGGAC 3 cut(s) 99, 104, 418
BsnI GGCC 2 cut(s) 186, 440
BsoBI CYCGRG 1 cut(s) 441
Bsp119I TTCGAA 1 cut(s) 196
Bsp1286I GDGCHC 1 cut(s) 381
Bsp1407I TGTACA 1 cut(s) 312
Bsp143I GATC 3 cut(s) 21, 62, 396
Bsp19I CCATGG 2 cut(s) 259, 461
BspACI CCGC 5 cut(s) 125, 267, 588, 785, 787
BspANI GGCC 2 cut(s) 186, 440
BspCNI CTCAG 3 cut(s) 85, 202, 684
BspDI ATCGAT 2 cut(s) 24, 171
BspFNI CGCG 1 cut(s) 787
BspHI TCATGA 1 cut(s) 105
BspLI GGNNCC 8 cut(s) 87, 88, 393, 428, 434, 715, 751, 791
BspMAI CTGCAG 1 cut(s) 780
BspMI ACCTGC 1 cut(s) 621
BspPI GGATC 1 cut(s) 70
BspT104I TTCGAA 1 cut(s) 196
BsrFI RCCGGY 1 cut(s) 706
BsrGI TGTACA 1 cut(s) 312
BsrI ACTGG 2 cut(s) 116, 731
BssAI RCCGGY 1 cut(s) 706
BssECI CCNNGG 8 cut(s) 259, 435, 442, 461, 502, 604, 720, 785
BssMI GATC 3 cut(s) 21, 62, 396
BssT1I CCWWGG 3 cut(s) 259, 461, 720
Bst2UI CCWGG 3 cut(s) 437, 503, 606
Bst4CI ACNGT 3 cut(s) 383, 491, 654
BstAUI TGTACA 1 cut(s) 312
BstBAI YACGTR 2 cut(s) 329, 738
BstBI TTCGAA 1 cut(s) 196
BstDEI CTNAG 4 cut(s) 44, 93, 210, 692
BstDSI CCRYGG 3 cut(s) 259, 461, 785
BstF5I GGATG 1 cut(s) 727
BstFNI CGCG 1 cut(s) 787
BstHHI GCGC 1 cut(s) 758
BstKTI GATC 3 cut(s) 24, 65, 399
BstMAI GTCTC 3 cut(s) 355, 389, 807
BstMBI GATC 3 cut(s) 21, 62, 396
BstMCI CGRYCG 2 cut(s) 73, 399
BstMWI GCNNNNNNNGC 6 cut(s) 273, 332, 338, 548, 646, 784
BstNI CCWGG 3 cut(s) 437, 503, 606
BstNSI RCATGY 2 cut(s) 301, 313
BstSCI CCNGG 4 cut(s) 387, 435, 501, 604
BstSFI CTRYAG 1 cut(s) 776
BstUI CGCG 1 cut(s) 787
BstV1I GCAGC 4 cut(s) 344, 529, 768, 790
BstXI CCANNNNNNTGG 1 cut(s) 260
Bsu15I ATCGAT 2 cut(s) 24, 171
Bsu36I CCTNAGG 1 cut(s) 93
BsuRI GGCC 2 cut(s) 186, 440
BsuTUI ATCGAT 2 cut(s) 24, 171
BtgI CCRYGG 3 cut(s) 259, 461, 785
BtsCI GGATG 1 cut(s) 727
BtsI GCAGTG 1 cut(s) 701
BtsIMutI CAGTG 1 cut(s) 701
BveI ACCTGC 1 cut(s) 621
CciI TCATGA 1 cut(s) 105
CfoI GCGC 1 cut(s) 758
Cfr10I RCCGGY 1 cut(s) 706
Cfr13I GGNCC 6 cut(s) 4, 86, 432, 439, 714, 724
Cfr42I CCGCGG 1 cut(s) 788
ClaI ATCGAT 2 cut(s) 24, 171
CseI GACGC 1 cut(s) 337
Csp6I GTAC 3 cut(s) 295, 301, 313
CviQI GTAC 3 cut(s) 295, 301, 313
DdeI CTNAG 4 cut(s) 44, 93, 210, 692
DpnI GATC 3 cut(s) 23, 64, 398
DpnII GATC 3 cut(s) 21, 62, 396
DrdI GACNNNNNNGTC 1 cut(s) 65
DseDI GACNNNNNNGTC 1 cut(s) 65
Eco130I CCWWGG 3 cut(s) 259, 461, 720
Eco47I GGWCC 5 cut(s) 4, 86, 432, 714, 724
Eco72I CACGTG 1 cut(s) 329
Eco81I CCTNAGG 1 cut(s) 93
Eco88I CYCGRG 1 cut(s) 441
EcoO109I RGGNCCY 1 cut(s) 86
EcoRII CCWGG 3 cut(s) 435, 501, 604
EcoT14I CCWWGG 3 cut(s) 259, 461, 720
ErhI CCWWGG 3 cut(s) 259, 461, 720
Esp3I CGTCTC 2 cut(s) 355, 389
FaqI GGGAC 3 cut(s) 99, 104, 418
FauI CCCGC 1 cut(s) 581
FauNDI CATATG 2 cut(s) 344, 454
FblI GTMKAC 1 cut(s) 69
Fnu4HI GCNGC 6 cut(s) 268, 333, 543, 779, 782, 785
FokI GGATG 1 cut(s) 714
Fsp4HI GCNGC 6 cut(s) 268, 333, 543, 779, 782, 785
FspBI CTAG 2 cut(s) 624, 671
GlaI GCGC 1 cut(s) 757
GluI GCNGC 6 cut(s) 268, 333, 543, 779, 782, 785
HaeIII GGCC 2 cut(s) 186, 440
HgaI GACGC 1 cut(s) 337
HhaI GCGC 1 cut(s) 758
Hin6I GCGC 1 cut(s) 756
HinP1I GCGC 1 cut(s) 756
HincII GTYRAC 1 cut(s) 70
HindII GTYRAC 1 cut(s) 70
HinfI GANTC 4 cut(s) 235, 449, 568, 592
HphI GGTGA 4 cut(s) 31, 458, 593, 648
Hpy166II GTNNAC 5 cut(s) 70, 315, 496, 682, 717
Hpy188I TCNGA 3 cut(s) 396, 637, 744
Hpy188III TCNNGA 3 cut(s) 106, 671, 691
Hpy8I GTNNAC 5 cut(s) 70, 315, 496, 682, 717
Hpy99I CGWCG 3 cut(s) 62, 146, 404
HpyAV CCTTC 2 cut(s) 10, 197
HpyCH4III ACNGT 3 cut(s) 383, 491, 654
HpyCH4IV ACGT 3 cut(s) 179, 328, 737
HpyCH4V TGCA 6 cut(s) 276, 332, 479, 545, 701, 778
HpyF10VI GCNNNNNNNGC 6 cut(s) 273, 332, 338, 548, 646, 784
HpyF3I CTNAG 4 cut(s) 44, 93, 210, 692
HpySE526I ACGT 3 cut(s) 179, 328, 737
HspAI GCGC 1 cut(s) 756
KflI GGGWCCC 1 cut(s) 86
KspI CCGCGG 1 cut(s) 788
Kzo9I GATC 3 cut(s) 21, 62, 396
LmnI GCTCC 4 cut(s) 376, 397, 432, 627
Lsp1109I GCAGC 4 cut(s) 344, 529, 768, 790
MaeI CTAG 2 cut(s) 624, 671
MaeII ACGT 3 cut(s) 179, 328, 737
MaeIII GTNAC 2 cut(s) 654, 733
MalI GATC 3 cut(s) 23, 64, 398
MboI GATC 3 cut(s) 21, 62, 396
MhlI GDGCHC 1 cut(s) 381
MluCI AATT 2 cut(s) 198, 578
MlyI GAGTC 2 cut(s) 244, 577
MmeI TCCRAC 1 cut(s) 747
MseI TTAA 1 cut(s) 486
MslI CAYNNNNRTG 2 cut(s) 258, 821
MspA1I CMGCKG 2 cut(s) 781, 787
MspR9I CCNGG 4 cut(s) 389, 437, 503, 606
MvaI CCWGG 3 cut(s) 437, 503, 606
MvnI CGCG 1 cut(s) 787
MwoI GCNNNNNNNGC 6 cut(s) 273, 332, 338, 548, 646, 784
NciI CCSGG 1 cut(s) 389
NcoI CCATGG 2 cut(s) 259, 461
NdeI CATATG 2 cut(s) 344, 454
NdeII GATC 3 cut(s) 21, 62, 396
NlaIV GGNNCC 8 cut(s) 87, 88, 393, 428, 434, 715, 751, 791
NmuCI GTSAC 1 cut(s) 654
NspI RCATGY 2 cut(s) 301, 313
NspV TTCGAA 1 cut(s) 196
PagI TCATGA 1 cut(s) 105
PciI ACATGT 2 cut(s) 297, 309
PcsI WCGNNNNNNNCGW 2 cut(s) 66, 345
PfeI GAWTC 2 cut(s) 449, 592
PflFI GACNNNGTC 1 cut(s) 164
PflMI CCANNNNNTGG 1 cut(s) 538
PkrI GCNGC 6 cut(s) 269, 334, 544, 780, 783, 786
Ple19I CGATCG 1 cut(s) 399
PleI GAGTC 2 cut(s) 243, 576
PmaCI CACGTG 1 cut(s) 329
PmlI CACGTG 1 cut(s) 329
PpsI GAGTC 2 cut(s) 243, 576
Ppu21I YACGTR 2 cut(s) 329, 738
PpuMI RGGWCCY 1 cut(s) 86
PscI ACATGT 2 cut(s) 297, 309
Psp5II RGGWCCY 1 cut(s) 86
Psp6I CCWGG 3 cut(s) 435, 501, 604
PspCI CACGTG 1 cut(s) 329
PspGI CCWGG 3 cut(s) 435, 501, 604
PspN4I GGNNCC 8 cut(s) 87, 88, 393, 428, 434, 715, 751, 791
PspPI GGNCC 6 cut(s) 4, 86, 432, 439, 714, 724
PspPPI RGGWCCY 1 cut(s) 86
PstI CTGCAG 1 cut(s) 780
PsyI GACNNNGTC 1 cut(s) 164
PvuI CGATCG 1 cut(s) 399
PvuII CAGCTG 1 cut(s) 781
RsaI GTAC 3 cut(s) 296, 302, 314
RsaNI GTAC 3 cut(s) 295, 301, 313
RseI CAYNNNNRTG 2 cut(s) 258, 821
SacII CCGCGG 1 cut(s) 788
SalI GTCGAC 1 cut(s) 68
SaqAI TTAA 1 cut(s) 486
SatI GCNGC 6 cut(s) 268, 333, 543, 779, 782, 785
Sau3AI GATC 3 cut(s) 21, 62, 396
Sau96I GGNCC 6 cut(s) 4, 86, 432, 439, 714, 724
SchI GAGTC 2 cut(s) 244, 577
ScrFI CCNGG 4 cut(s) 389, 437, 503, 606
SduI GDGCHC 1 cut(s) 381
SfcI CTRYAG 1 cut(s) 776
Sfr303I CCGCGG 1 cut(s) 788
SfuI TTCGAA 1 cut(s) 196
SgrBI CCGCGG 1 cut(s) 788
SinI GGWCC 5 cut(s) 4, 86, 432, 714, 724
SmiMI CAYNNNNRTG 2 cut(s) 258, 821
Sse9I AATT 2 cut(s) 198, 578
SsiI CCGC 5 cut(s) 125, 267, 588, 785, 787
SspMI CTAG 2 cut(s) 624, 671
StyD4I CCNGG 4 cut(s) 387, 435, 501, 604
StyI CCWWGG 3 cut(s) 259, 461, 720
TaaI ACNGT 3 cut(s) 383, 491, 654
TaiI ACGT 3 cut(s) 182, 331, 740
TaqI TCGA 7 cut(s) 24, 69, 141, 171, 190, 196, 399
TasI AATT 2 cut(s) 198, 578
TatI WGTACW 2 cut(s) 300, 312
TauI GCSGC 2 cut(s) 270, 787
TfiI GAWTC 2 cut(s) 449, 592
Tru1I TTAA 1 cut(s) 486
Tru9I TTAA 1 cut(s) 486
TscAI CASTG 1 cut(s) 708
TseFI GTSAC 1 cut(s) 654
TseI GCWGC 4 cut(s) 332, 542, 778, 781
Tsp45I GTSAC 1 cut(s) 654
TspDTI ATGAA 6 cut(s) 94, 127, 189, 441, 471, 549
TspGWI ACGGA 3 cut(s) 75, 159, 343
TspRI CASTG 1 cut(s) 708
Tth111I GACNNNGTC 1 cut(s) 164
Van91I CCANNNNNTGG 1 cut(s) 538
VpaK11BI GGWCC 5 cut(s) 4, 86, 432, 714, 724
XapI RAATTY 1 cut(s) 198
XbaI TCTAGA 1 cut(s) 670
XceI RCATGY 2 cut(s) 301, 313
XmiI GTMKAC 1 cut(s) 69
XspI CTAG 2 cut(s) 624, 671
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.