Rmu_sc0005527.1_g000004

carboxylesterase 15

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005527.1
OG0000918
Physical Location & Seq
Forward (+)
17481 .. 18068
588 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005527.1_g000004.1.cds

Sequence Viewer

Length: 588 bp
atggtccaagaaaagaaggtgatcgatgaggtttccggttggcttaggctctttgacgacggatcagtcgaccggacatggacgggaccccctgaggtcaagttcatgacagagccagtcccaccgcacattgagttcatcgacggagttgcgacaaaagacatggtcatcgatgaaacgtccggccttcgagttcgaatttacttacctgagagaaagccggaggattgtgagagtctgcccatatttctccacttccatggaggcggcttttgcattagccaagcagattggtacatgtactaccacatgtacacaaacctcgcacgtgcagccaacgccatatgcgtctccgtctatctacgcctcgcaccggagcaccgtctcccggctccgatcgacgatggcttctctgctctcctctggctccggtccctggcccgaggtgattcatatgaaccatggttcaacgaccatgcagactttaaccgtgtttacctcctgggggatagcacaggaggaaacatagtccatgaagtggctgcaagagcagggaagctggatttgagtcacctaacagatgtctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0009056 GO:0016787
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

195

Amino Acids

22.11

Weight (kDa)

5.06

Isoelectric Point (pI)

44.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 65
AccB7I CCANNNNNTGG 1 cut(s) 538
AccI GTMKAC 1 cut(s) 69
AciI CCGC 2 cut(s) 125, 267
AclWI GGATC 1 cut(s) 70
AcsI RAATTY 1 cut(s) 198
AcvI CACGTG 1 cut(s) 329
AfaI GTAC 3 cut(s) 296, 302, 314
AfiI CCNNNNNNNGG 5 cut(s) 373, 388, 436, 505, 538
AflIII ACRYGT 2 cut(s) 297, 309
AgsI TTSAA 1 cut(s) 469
AjnI CCWGG 2 cut(s) 435, 501
AluBI AGCT 1 cut(s) 559
AluI AGCT 1 cut(s) 559
Alw21I GWGCWC 1 cut(s) 381
Alw26I GTCTC 2 cut(s) 355, 389
AlwI GGATC 1 cut(s) 70
Ama87I CYCGRG 1 cut(s) 441
AoxI GGCC 2 cut(s) 184, 438
ApeKI GCWGC 2 cut(s) 332, 542
ApoI RAATTY 1 cut(s) 198
AspS9I GGNCC 4 cut(s) 4, 86, 432, 439
AsuC2I CCSGG 1 cut(s) 389
AsuHPI GGTGA 3 cut(s) 31, 458, 563
AsuII TTCGAA 1 cut(s) 196
AvaI CYCGRG 1 cut(s) 441
AvaII GGWCC 3 cut(s) 4, 86, 432
AxyI CCTNAGG 1 cut(s) 93
BbrPI CACGTG 1 cut(s) 329
Bbv12I GWGCWC 1 cut(s) 381
BbvI GCAGC 2 cut(s) 344, 529
BccI CCATC 1 cut(s) 398
BcgI CGANNNNNNTGC 2 cut(s) 131, 165
BciT130I CCWGG 2 cut(s) 437, 503
BcnI CCSGG 1 cut(s) 389
BcoDI GTCTC 2 cut(s) 355, 389
BisI GCNGC 3 cut(s) 268, 333, 543
BlsI GCNGC 3 cut(s) 269, 334, 544
Bme1390I CCNGG 3 cut(s) 389, 437, 503
Bme18I GGWCC 3 cut(s) 4, 86, 432
BmeT110I CYCGRG 1 cut(s) 441
BmgT120I GGNCC 4 cut(s) 4, 86, 432, 439
BmiI GGNNCC 5 cut(s) 87, 88, 393, 428, 434
BmrFI CCNGG 3 cut(s) 389, 437, 503
Bpu10I CCTNAGC 1 cut(s) 44
Bpu14I TTCGAA 1 cut(s) 196
BpuMI CCSGG 1 cut(s) 389
Bsa29I ATCGAT 2 cut(s) 24, 171
BsaAI YACGTR 1 cut(s) 329
BsaJI CCNNGG 5 cut(s) 259, 435, 442, 461, 502
BsaWI WCCGGW 4 cut(s) 35, 72, 373, 429
Bsc4I CCNNNNNNNGG 5 cut(s) 373, 388, 436, 505, 538
Bse1I ACTGG 1 cut(s) 116
Bse21I CCTNAGG 1 cut(s) 93
BseBI CCWGG 2 cut(s) 437, 503
BseCI ATCGAT 2 cut(s) 24, 171
BseDI CCNNGG 5 cut(s) 259, 435, 442, 461, 502
BseLI CCNNNNNNNGG 5 cut(s) 373, 388, 436, 505, 538
BseMII CTCAG 2 cut(s) 84, 201
BseNI ACTGG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 410
BseXI GCAGC 2 cut(s) 344, 529
BsgI GTGCAG 1 cut(s) 351
Bsh1285I CGRYCG 2 cut(s) 73, 399
BshFI GGCC 2 cut(s) 186, 440
BshVI ATCGAT 2 cut(s) 24, 171
BsiEI CGRYCG 2 cut(s) 73, 399
BsiHKAI GWGCWC 1 cut(s) 381
BsiHKCI CYCGRG 1 cut(s) 441
BsiSI CCGG 7 cut(s) 36, 73, 183, 221, 374, 389, 430
BslFI GGGAC 3 cut(s) 99, 104, 418
BslI CCNNNNNNNGG 5 cut(s) 373, 388, 436, 505, 538
BsmAI GTCTC 2 cut(s) 355, 389
BsmBI CGTCTC 2 cut(s) 355, 389
BsmFI GGGAC 3 cut(s) 99, 104, 418
BsnI GGCC 2 cut(s) 186, 440
BsoBI CYCGRG 1 cut(s) 441
Bsp119I TTCGAA 1 cut(s) 196
Bsp1286I GDGCHC 1 cut(s) 381
Bsp1407I TGTACA 1 cut(s) 312
Bsp143I GATC 3 cut(s) 21, 62, 396
Bsp19I CCATGG 2 cut(s) 259, 461
BspACI CCGC 2 cut(s) 125, 267
BspANI GGCC 2 cut(s) 186, 440
BspCNI CTCAG 2 cut(s) 85, 202
BspDI ATCGAT 2 cut(s) 24, 171
BspHI TCATGA 1 cut(s) 105
BspLI GGNNCC 5 cut(s) 87, 88, 393, 428, 434
BspPI GGATC 1 cut(s) 70
BspT104I TTCGAA 1 cut(s) 196
BsrGI TGTACA 1 cut(s) 312
BsrI ACTGG 1 cut(s) 116
BssECI CCNNGG 5 cut(s) 259, 435, 442, 461, 502
BssMI GATC 3 cut(s) 21, 62, 396
BssT1I CCWWGG 2 cut(s) 259, 461
Bst2UI CCWGG 2 cut(s) 437, 503
Bst4CI ACNGT 2 cut(s) 383, 491
BstAUI TGTACA 1 cut(s) 312
BstBAI YACGTR 1 cut(s) 329
BstBI TTCGAA 1 cut(s) 196
BstDEI CTNAG 3 cut(s) 44, 93, 210
BstDSI CCRYGG 2 cut(s) 259, 461
BstKTI GATC 3 cut(s) 24, 65, 399
BstMAI GTCTC 2 cut(s) 355, 389
BstMBI GATC 3 cut(s) 21, 62, 396
BstMCI CGRYCG 2 cut(s) 73, 399
BstMWI GCNNNNNNNGC 4 cut(s) 273, 332, 338, 548
BstNI CCWGG 2 cut(s) 437, 503
BstNSI RCATGY 2 cut(s) 301, 313
BstSCI CCNGG 3 cut(s) 387, 435, 501
BstV1I GCAGC 2 cut(s) 344, 529
BstXI CCANNNNNNTGG 1 cut(s) 260
Bsu15I ATCGAT 2 cut(s) 24, 171
Bsu36I CCTNAGG 1 cut(s) 93
BsuRI GGCC 2 cut(s) 186, 440
BsuTUI ATCGAT 2 cut(s) 24, 171
BtgI CCRYGG 2 cut(s) 259, 461
CciI TCATGA 1 cut(s) 105
Cfr13I GGNCC 4 cut(s) 4, 86, 432, 439
ClaI ATCGAT 2 cut(s) 24, 171
CseI GACGC 1 cut(s) 337
Csp6I GTAC 3 cut(s) 295, 301, 313
CviAII CATG 9 cut(s) 78, 106, 163, 260, 298, 310, 462, 476, 533
CviQI GTAC 3 cut(s) 295, 301, 313
DdeI CTNAG 3 cut(s) 44, 93, 210
DpnI GATC 3 cut(s) 23, 64, 398
DpnII GATC 3 cut(s) 21, 62, 396
DrdI GACNNNNNNGTC 1 cut(s) 65
DseDI GACNNNNNNGTC 1 cut(s) 65
Eco130I CCWWGG 2 cut(s) 259, 461
Eco47I GGWCC 3 cut(s) 4, 86, 432
Eco72I CACGTG 1 cut(s) 329
Eco81I CCTNAGG 1 cut(s) 93
Eco88I CYCGRG 1 cut(s) 441
EcoO109I RGGNCCY 1 cut(s) 86
EcoRII CCWGG 2 cut(s) 435, 501
EcoT14I CCWWGG 2 cut(s) 259, 461
ErhI CCWWGG 2 cut(s) 259, 461
Esp3I CGTCTC 2 cut(s) 355, 389
FaeI CATG 9 cut(s) 81, 109, 166, 263, 301, 313, 465, 479, 536
FaqI GGGAC 3 cut(s) 99, 104, 418
FatI CATG 9 cut(s) 77, 105, 162, 259, 297, 309, 461, 475, 532
FauNDI CATATG 2 cut(s) 344, 454
FblI GTMKAC 1 cut(s) 69
Fnu4HI GCNGC 3 cut(s) 268, 333, 543
Fsp4HI GCNGC 3 cut(s) 268, 333, 543
GluI GCNGC 3 cut(s) 268, 333, 543
HaeIII GGCC 2 cut(s) 186, 440
HapII CCGG 7 cut(s) 36, 73, 183, 221, 374, 389, 430
HgaI GACGC 1 cut(s) 337
Hin1II CATG 9 cut(s) 81, 109, 166, 263, 301, 313, 465, 479, 536
HincII GTYRAC 1 cut(s) 70
HindII GTYRAC 1 cut(s) 70
HinfI GANTC 3 cut(s) 235, 449, 568
HpaII CCGG 7 cut(s) 36, 73, 183, 221, 374, 389, 430
HphI GGTGA 3 cut(s) 31, 458, 563
Hpy166II GTNNAC 3 cut(s) 70, 315, 496
Hpy188I TCNGA 1 cut(s) 396
Hpy188III TCNNGA 1 cut(s) 106
Hpy8I GTNNAC 3 cut(s) 70, 315, 496
Hpy99I CGWCG 3 cut(s) 62, 146, 404
HpyAV CCTTC 2 cut(s) 10, 197
HpyCH4III ACNGT 2 cut(s) 383, 491
HpyCH4IV ACGT 2 cut(s) 179, 328
HpyCH4V TGCA 4 cut(s) 276, 332, 479, 545
HpyF10VI GCNNNNNNNGC 4 cut(s) 273, 332, 338, 548
HpyF3I CTNAG 3 cut(s) 44, 93, 210
HpySE526I ACGT 2 cut(s) 179, 328
Hsp92II CATG 9 cut(s) 81, 109, 166, 263, 301, 313, 465, 479, 536
KflI GGGWCCC 1 cut(s) 86
Kzo9I GATC 3 cut(s) 21, 62, 396
LmnI GCTCC 3 cut(s) 376, 397, 432
Lsp1109I GCAGC 2 cut(s) 344, 529
MaeII ACGT 2 cut(s) 179, 328
MaeIII GTNAC 1 cut(s) 569
MalI GATC 3 cut(s) 23, 64, 398
MboI GATC 3 cut(s) 21, 62, 396
MhlI GDGCHC 1 cut(s) 381
MluCI AATT 1 cut(s) 198
MlyI GAGTC 2 cut(s) 244, 577
MseI TTAA 1 cut(s) 486
MslI CAYNNNNRTG 1 cut(s) 258
MspI CCGG 7 cut(s) 36, 73, 183, 221, 374, 389, 430
MspR9I CCNGG 3 cut(s) 389, 437, 503
MvaI CCWGG 2 cut(s) 437, 503
MwoI GCNNNNNNNGC 4 cut(s) 273, 332, 338, 548
NciI CCSGG 1 cut(s) 389
NcoI CCATGG 2 cut(s) 259, 461
NdeI CATATG 2 cut(s) 344, 454
NdeII GATC 3 cut(s) 21, 62, 396
NlaIII CATG 9 cut(s) 81, 109, 166, 263, 301, 313, 465, 479, 536
NlaIV GGNNCC 5 cut(s) 87, 88, 393, 428, 434
NmuCI GTSAC 1 cut(s) 569
NspI RCATGY 2 cut(s) 301, 313
NspV TTCGAA 1 cut(s) 196
PagI TCATGA 1 cut(s) 105
PciI ACATGT 2 cut(s) 297, 309
PcsI WCGNNNNNNNCGW 2 cut(s) 66, 345
PfeI GAWTC 1 cut(s) 449
PflFI GACNNNGTC 1 cut(s) 164
PflMI CCANNNNNTGG 1 cut(s) 538
PkrI GCNGC 3 cut(s) 269, 334, 544
Ple19I CGATCG 1 cut(s) 399
PleI GAGTC 2 cut(s) 243, 576
PmaCI CACGTG 1 cut(s) 329
PmlI CACGTG 1 cut(s) 329
PpsI GAGTC 2 cut(s) 243, 576
Ppu21I YACGTR 1 cut(s) 329
PpuMI RGGWCCY 1 cut(s) 86
PscI ACATGT 2 cut(s) 297, 309
Psp5II RGGWCCY 1 cut(s) 86
Psp6I CCWGG 2 cut(s) 435, 501
PspCI CACGTG 1 cut(s) 329
PspGI CCWGG 2 cut(s) 435, 501
PspN4I GGNNCC 5 cut(s) 87, 88, 393, 428, 434
PspPI GGNCC 4 cut(s) 4, 86, 432, 439
PspPPI RGGWCCY 1 cut(s) 86
PsyI GACNNNGTC 1 cut(s) 164
PvuI CGATCG 1 cut(s) 399
RsaI GTAC 3 cut(s) 296, 302, 314
RsaNI GTAC 3 cut(s) 295, 301, 313
RseI CAYNNNNRTG 1 cut(s) 258
SalI GTCGAC 1 cut(s) 68
SaqAI TTAA 1 cut(s) 486
SatI GCNGC 3 cut(s) 268, 333, 543
Sau3AI GATC 3 cut(s) 21, 62, 396
Sau96I GGNCC 4 cut(s) 4, 86, 432, 439
SchI GAGTC 2 cut(s) 244, 577
ScrFI CCNGG 3 cut(s) 389, 437, 503
SduI GDGCHC 1 cut(s) 381
SfuI TTCGAA 1 cut(s) 196
SinI GGWCC 3 cut(s) 4, 86, 432
SmiMI CAYNNNNRTG 1 cut(s) 258
Sse9I AATT 1 cut(s) 198
SsiI CCGC 2 cut(s) 125, 267
StyD4I CCNGG 3 cut(s) 387, 435, 501
StyI CCWWGG 2 cut(s) 259, 461
TaaI ACNGT 2 cut(s) 383, 491
TaiI ACGT 2 cut(s) 182, 331
TaqI TCGA 7 cut(s) 24, 69, 141, 171, 190, 196, 399
TasI AATT 1 cut(s) 198
TatI WGTACW 2 cut(s) 300, 312
TauI GCSGC 1 cut(s) 270
TfiI GAWTC 1 cut(s) 449
Tru1I TTAA 1 cut(s) 486
Tru9I TTAA 1 cut(s) 486
TseFI GTSAC 1 cut(s) 569
TseI GCWGC 2 cut(s) 332, 542
Tsp45I GTSAC 1 cut(s) 569
TspDTI ATGAA 6 cut(s) 94, 127, 189, 441, 471, 549
TspGWI ACGGA 3 cut(s) 75, 159, 343
Tth111I GACNNNGTC 1 cut(s) 164
Van91I CCANNNNNTGG 1 cut(s) 538
VpaK11BI GGWCC 3 cut(s) 4, 86, 432
XapI RAATTY 1 cut(s) 198
XceI RCATGY 2 cut(s) 301, 313
XmiI GTMKAC 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.